ID: 1077497692

View in Genome Browser
Species Human (GRCh38)
Location 11:2894339-2894361
Sequence CTGCTTCAAATTAAAACCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 214}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077497692_1077497697 1 Left 1077497692 11:2894339-2894361 CCCCAGGTTTTAATTTGAAGCAG 0: 1
1: 0
2: 0
3: 12
4: 214
Right 1077497697 11:2894363-2894385 TAGTGAATTGAGCTTATGTGGGG 0: 1
1: 0
2: 0
3: 9
4: 136
1077497692_1077497695 -1 Left 1077497692 11:2894339-2894361 CCCCAGGTTTTAATTTGAAGCAG 0: 1
1: 0
2: 0
3: 12
4: 214
Right 1077497695 11:2894361-2894383 GTTAGTGAATTGAGCTTATGTGG 0: 1
1: 0
2: 1
3: 6
4: 86
1077497692_1077497699 24 Left 1077497692 11:2894339-2894361 CCCCAGGTTTTAATTTGAAGCAG 0: 1
1: 0
2: 0
3: 12
4: 214
Right 1077497699 11:2894386-2894408 TCTTATTTGTATTTGCTTTTGGG 0: 1
1: 1
2: 13
3: 268
4: 2896
1077497692_1077497696 0 Left 1077497692 11:2894339-2894361 CCCCAGGTTTTAATTTGAAGCAG 0: 1
1: 0
2: 0
3: 12
4: 214
Right 1077497696 11:2894362-2894384 TTAGTGAATTGAGCTTATGTGGG 0: 1
1: 0
2: 1
3: 11
4: 118
1077497692_1077497698 23 Left 1077497692 11:2894339-2894361 CCCCAGGTTTTAATTTGAAGCAG 0: 1
1: 0
2: 0
3: 12
4: 214
Right 1077497698 11:2894385-2894407 GTCTTATTTGTATTTGCTTTTGG 0: 1
1: 0
2: 6
3: 168
4: 2296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077497692 Original CRISPR CTGCTTCAAATTAAAACCTG GGG (reversed) Intronic
900788063 1:4661948-4661970 TTTCTTGAAATTAAAAACTGTGG + Intronic
901266329 1:7913705-7913727 CTGCTTCTAACTAAAATCCGAGG + Intergenic
901336515 1:8453987-8454009 CTGTTTAATATTAAAATCTGTGG - Intronic
907756146 1:57312764-57312786 CTGCTGCAAATGAGAACCTTTGG - Intronic
908718904 1:67101610-67101632 CTGCTTCATATTATAATATGAGG + Intronic
908740184 1:67319320-67319342 CTGTTTCAAATTCAAACCCAAGG - Intronic
909251144 1:73357972-73357994 CTACTTCACATTAAAAAGTGAGG + Intergenic
909651192 1:77978263-77978285 CAGATTCAAATTGAAACCTCTGG + Intronic
909665440 1:78127086-78127108 CTGATTCAAATGCATACCTGTGG - Intronic
910363498 1:86438904-86438926 CTGCATCAAATAAAATTCTGCGG - Exonic
911297519 1:96135364-96135386 ATCCTTCAAATTAAAACCAGAGG - Intergenic
911331259 1:96528411-96528433 CTGCTTTAAAGTAAAAACTTTGG - Intergenic
911550316 1:99270579-99270601 TTGCTACAATTAAAAACCTGTGG - Intronic
912370519 1:109170682-109170704 TTGCTTCAAATTAAAACCCCTGG - Intronic
916493983 1:165328165-165328187 CTGTTTCAAACAGAAACCTGTGG + Intronic
917115089 1:171594947-171594969 ATGCTCTAAATTAAAAGCTGTGG + Intergenic
917185096 1:172344637-172344659 CGGCTCCAAATCAAAAGCTGTGG - Intronic
917788024 1:178480371-178480393 CTGCTTTAAATTGAAGCCAGTGG - Intergenic
918730519 1:187987937-187987959 GTGATTAAAATTAAAGCCTGAGG - Intergenic
918805393 1:189034557-189034579 GTGCTTCAACTTAAAGCATGGGG - Intergenic
920736246 1:208535508-208535530 CTGCATGAAATTTAAACCTTAGG + Intergenic
923910710 1:238439866-238439888 CTACTTCATAAAAAAACCTGTGG - Intergenic
1062851391 10:745437-745459 CGGGTTCAAGTAAAAACCTGGGG - Intergenic
1064778121 10:18802962-18802984 TTCTTTCAAATTAAACCCTGTGG + Intergenic
1065422091 10:25556317-25556339 CTGCTTCACGTTAAAACCCTTGG - Intronic
1065624368 10:27615463-27615485 CTGCTGCAAAGGAAAACCTCAGG + Intergenic
1065770378 10:29072563-29072585 ATGCTTCAAATCAAGACCTTTGG - Intergenic
1065951373 10:30654739-30654761 CTGCCTCAAATTAAAATTTTGGG + Intergenic
1068616311 10:59121902-59121924 CTCCTTTGAATCAAAACCTGTGG + Intergenic
1077497692 11:2894339-2894361 CTGCTTCAAATTAAAACCTGGGG - Intronic
1080079061 11:28193009-28193031 CTGCTTATAATTAAAATCTTAGG + Intronic
1080164268 11:29218118-29218140 CTGATTCACAATAAAAACTGTGG - Intergenic
1080212813 11:29806676-29806698 CTGCCTCAAGCTAAATCCTGAGG - Intergenic
1080814004 11:35736343-35736365 ATTCTTCAAAATAAACCCTGAGG + Intronic
1081366753 11:42244367-42244389 CTGTTTCACATTGAAACATGGGG + Intergenic
1084837773 11:71816066-71816088 CAGCTTTAACTTAAAACATGTGG - Intergenic
1085694607 11:78693445-78693467 CTGTTTCAAATAAAAATCTTTGG + Intronic
1087059653 11:93965154-93965176 TTGCTTTAAATAAATACCTGAGG + Intergenic
1087081806 11:94178143-94178165 TTACTTCAAATTAATACCTATGG + Intronic
1087361866 11:97170888-97170910 CTGCTTCAAATTTCAACCGGTGG + Intergenic
1087975256 11:104537324-104537346 GTGCCTCAAATTAGAGCCTGTGG - Intergenic
1088567754 11:111190908-111190930 CTGGTTCCAAATAAAATCTGTGG - Intergenic
1089914547 11:122140227-122140249 CTGCTTAAAACTAAAACTTTTGG - Intergenic
1090583572 11:128185787-128185809 TTGGTTCAAAATAAAACATGAGG + Intergenic
1090644488 11:128756842-128756864 CTGCTACCAATCAAAACATGAGG - Intronic
1092400923 12:8178007-8178029 CAGCTTTAACTTAAAACATGTGG + Exonic
1092872351 12:12816934-12816956 CTGCATCAAATTTAAACTTATGG - Intronic
1096306169 12:50479187-50479209 CTGTGTCAAAGTAAAACCAGTGG - Exonic
1098729645 12:74016915-74016937 TTGTTTCAAAATAAAATCTGTGG + Intergenic
1099580858 12:84445402-84445424 CTGCTTAAAATTAAACCTGGTGG + Intergenic
1100767284 12:97881237-97881259 CTGCTTCATATTAATAGTTGTGG + Intergenic
1101046505 12:100811674-100811696 CTGCATCAAACTAGAACCTTTGG - Intronic
1112078901 13:95945438-95945460 CTGCTTTGTATTAAACCCTGTGG + Intronic
1114714875 14:24814496-24814518 CTGCTGAAAATTAATAGCTGTGG - Intronic
1116065784 14:39981258-39981280 TTTCTTCCAATTAGAACCTGTGG - Intergenic
1116923403 14:50606169-50606191 CTGCTTCAAATAATAAACTGAGG - Intronic
1117323552 14:54647725-54647747 CTCCTTAAAATTGAAACATGAGG + Intronic
1120326378 14:83034192-83034214 CAGTTTCTAATTAAAACCTTAGG + Intergenic
1121362158 14:93271645-93271667 CTGCCTGAATTTAAAACCTATGG - Intronic
1123172213 14:106384958-106384980 CTGCTATAAATTAATACCTGAGG + Intergenic
1124365286 15:29066863-29066885 CTGCTTTAAAGAAATACCTGGGG + Intronic
1124559543 15:30758970-30758992 CTGCTTGAAATTAAACACTTTGG + Intronic
1124671710 15:31646757-31646779 CTGCTTAAAATTAAACACTTTGG - Intronic
1125060614 15:35417926-35417948 CTGCATTACATTAAAACCTTTGG + Intronic
1125211522 15:37221354-37221376 CTAGTTCAAATTAAAACTTCAGG + Intergenic
1125749834 15:42020760-42020782 CAGCCTCATCTTAAAACCTGGGG - Intronic
1126173172 15:45711306-45711328 CTCCCTCAAACTAAAACTTGAGG - Intergenic
1128202470 15:65821015-65821037 CTGCATCAAATTATAGCTTGAGG + Intronic
1130011598 15:80156815-80156837 GTGCTTCAAACTATGACCTGAGG - Intronic
1130627425 15:85529842-85529864 CTTTTTCAAAAGAAAACCTGAGG - Intronic
1132283169 15:100638234-100638256 CTGTTTAAAGTTAAAATCTGTGG + Intronic
1133009204 16:2900951-2900973 ATGTTTCAAAATAAAACCAGAGG - Intergenic
1133877293 16:9747306-9747328 CTGCTCCAAAGAAAAAGCTGAGG + Intergenic
1135237216 16:20768536-20768558 CTGCTGCACATTAAAATCTGAGG + Intronic
1135801486 16:25501104-25501126 CTACTTCATAGTAAAATCTGAGG + Intergenic
1136171464 16:28492202-28492224 CCGCTCCAGTTTAAAACCTGCGG - Exonic
1137356081 16:47765865-47765887 CTGCTATAAATTAGATCCTGTGG - Intergenic
1137378060 16:47971658-47971680 CATCTTCAAATAAAAATCTGTGG + Intergenic
1138946677 16:61859541-61859563 CTACTTCCAATTAAATCCGGAGG - Intronic
1140947182 16:79779881-79779903 CTTCTTCAACTTAAAGCCTTAGG - Intergenic
1143565563 17:7718229-7718251 CTGCCTCAAACTAGAGCCTGAGG - Exonic
1150206543 17:63413025-63413047 CTGCTTCAAAGTGAATCCCGGGG + Intronic
1151051930 17:70987972-70987994 CTGTTTCAAATTAACATCGGTGG - Intergenic
1151404824 17:73879456-73879478 CTGCCACAAATTAATACCTGGGG + Intergenic
1151450807 17:74197136-74197158 ATGCTTCAAATTAAAAACCAGGG - Intergenic
1152275091 17:79351816-79351838 TTCCTCAAAATTAAAACCTGAGG - Intronic
1152533606 17:80937450-80937472 CTGTTGCAAAGAAAAACCTGGGG - Intronic
1154048204 18:10927577-10927599 CTGGTTCAAATTTAAAACTAAGG - Intronic
1154206956 18:12345675-12345697 CTGCCTCAGAGCAAAACCTGCGG + Intronic
1154347167 18:13551784-13551806 CTGCTACAAAGGAATACCTGAGG + Intronic
1155457940 18:26041062-26041084 GTGCTTCAAAATAAAATTTGAGG - Intronic
1156755545 18:40520166-40520188 CTGCTTCATCTGAAAACATGGGG - Intergenic
1157401479 18:47392109-47392131 CTGCTACAAAGAAATACCTGAGG - Intergenic
1157887709 18:51384553-51384575 CTGCTACAAATTAAAAGCACAGG - Intergenic
1158005825 18:52671029-52671051 CTGCTTCCAATGACAACATGAGG - Intronic
1159517756 18:69479504-69479526 CTGCAGCAAAGTAAAAGCTGAGG - Intronic
1159758872 18:72399692-72399714 CTGCATGGAATTAAGACCTGTGG - Intergenic
1165521027 19:36314130-36314152 ATGCTTCAGATCTAAACCTGTGG + Intergenic
1165623042 19:37264458-37264480 ATGCTTCAGATCTAAACCTGTGG - Intergenic
1167223560 19:48220161-48220183 CTGCTTCATATTAATTGCTGTGG + Intronic
1167840545 19:52114372-52114394 TTGCTACAAAAAAAAACCTGAGG + Exonic
1167856186 19:52242325-52242347 GTGCTTCCAATTCAAATCTGTGG + Intergenic
925818163 2:7773695-7773717 CTGCTGCCAAGTGAAACCTGTGG - Intergenic
926391604 2:12399727-12399749 CAGCTACAAATGAAAACCTCAGG - Intergenic
930980655 2:57522734-57522756 CTGCTATAAATAAATACCTGAGG - Intergenic
931117006 2:59175691-59175713 CTGGGTAATATTAAAACCTGAGG + Intergenic
931212202 2:60207778-60207800 CTGCTTAAAAATGAAACCTGGGG - Intergenic
935164446 2:100557910-100557932 TTGCTGCAAATGAATACCTGAGG + Intergenic
935444307 2:103139991-103140013 TTTCTTCAAATTAAAACCCAAGG - Intergenic
937580327 2:123478351-123478373 ATGCTTCTAAGTATAACCTGTGG + Intergenic
938304586 2:130243407-130243429 CTTCCTTGAATTAAAACCTGTGG + Intergenic
938601282 2:132842888-132842910 ATACTTCATATCAAAACCTGTGG - Intronic
939436615 2:142185235-142185257 CTGCTTCAAATACCTACCTGAGG - Intergenic
941665460 2:168240265-168240287 GTGCTTCAAATTAAGTCTTGAGG + Intronic
943591682 2:189805646-189805668 CTTGTTGTAATTAAAACCTGGGG - Exonic
943737106 2:191368279-191368301 CTGCTTCTAAGTAAAAATTGGGG - Intronic
944368769 2:198956306-198956328 TTCCTTCTGATTAAAACCTGTGG + Intergenic
944441282 2:199746138-199746160 CTGCTTTAACATAAAACCTTGGG - Intergenic
944679429 2:202063511-202063533 CTGCTTGAGAGTAAAAACTGCGG - Intergenic
945563271 2:211364683-211364705 GAGCTTCAAAACAAAACCTGAGG - Intergenic
946353507 2:219170409-219170431 CTACTTCAAAATGAAACTTGTGG + Intronic
947294812 2:228618582-228618604 CTGCTTTACATTTAAATCTGTGG + Intergenic
947948732 2:234129279-234129301 CTGCTTTAAATTAAAATGTGAGG + Intergenic
948663719 2:239521884-239521906 CTGCCTCAAAGTAAAGCCAGTGG + Intergenic
1169979487 20:11367087-11367109 CTGCTTCAAAAAAGAACCAGTGG - Intergenic
1171103728 20:22411825-22411847 CAGCTTCAGAATAAAACCAGTGG - Intergenic
1178371550 21:32031252-32031274 CTGCTACAAAGAAATACCTGAGG - Intronic
1181907816 22:26213176-26213198 TTGCTTTAAAAGAAAACCTGGGG - Intronic
1182163841 22:28151862-28151884 CTGCTTTAGATGAAAAGCTGAGG + Intronic
1182837756 22:33358104-33358126 CTGCCTCATATTTAATCCTGAGG + Intronic
949381710 3:3454191-3454213 CTGCTATAAATAAATACCTGAGG + Intergenic
949564156 3:5229579-5229601 CTGCTATAAATAAATACCTGAGG - Intergenic
950288230 3:11762004-11762026 CTGCTTCAAATTGGGGCCTGGGG - Intergenic
950900438 3:16492734-16492756 CAACTTACAATTAAAACCTGTGG + Intronic
951954613 3:28241041-28241063 CTCCTTCAAATCAAAGACTGTGG - Intergenic
952175433 3:30857703-30857725 TTCTTTCAAAGTAAAACCTGAGG + Intronic
952645574 3:35654044-35654066 CTGCTTCAAATTAAGATGGGTGG - Intronic
953151119 3:40325980-40326002 GGGCTTCAGGTTAAAACCTGAGG - Intergenic
954940983 3:54373046-54373068 CTGCTCCAACTTGAAACATGGGG - Intronic
956998898 3:74861432-74861454 CAGCTGCAAATTAAAACCATAGG - Intergenic
957896564 3:86427520-86427542 CCGCTCCCATTTAAAACCTGAGG + Intergenic
963769743 3:149378071-149378093 CTGATTTAATTTACAACCTGGGG + Intergenic
963994779 3:151694885-151694907 CTGTTTCAAATGAAAAGCTTGGG - Intergenic
964129669 3:153272731-153272753 CTGCTATAAATAAATACCTGAGG - Intergenic
964387387 3:156162831-156162853 CTGCTTCAAATTTACACCAAAGG + Intronic
964480832 3:157136856-157136878 CTGCTTCAAATTAAGCCCCAAGG - Intergenic
966778100 3:183560776-183560798 CTGGTTCCAGTTAATACCTGAGG + Intergenic
969553198 4:7886279-7886301 CTGCTGTAAATAAAAACCTCTGG + Intronic
969779190 4:9383571-9383593 CAGCTTTAACTTAAAACATGTGG - Intergenic
975608325 4:76178909-76178931 CAGCTACAAATTTAAAGCTGAGG + Intronic
979461989 4:120994441-120994463 CTGCTACAGAGTAATACCTGAGG + Intergenic
979895766 4:126155281-126155303 ATGCTTCCCATTAAAACCTTAGG + Intergenic
981667880 4:147250509-147250531 ATGCTTAAAAGTAAAGCCTGGGG + Intergenic
982884459 4:160760960-160760982 CTGCATCACATAAAAAACTGTGG - Intergenic
982914413 4:161188077-161188099 CTGCTTCCATCTAAAACCTCAGG - Intergenic
983261597 4:165462743-165462765 CTCCCTCAAAGTAAAAACTGAGG + Intronic
983538677 4:168885562-168885584 GTGCTTGAAATTGAAACTTGAGG - Intronic
984010988 4:174371323-174371345 CTGATTCAACTGACAACCTGTGG - Intergenic
986838967 5:11673974-11673996 CGGCTTCATATTTAAAACTGAGG - Intronic
989524568 5:42438636-42438658 CAGCTTCAAATGAGGACCTGAGG + Intronic
991430138 5:66535903-66535925 CTGTTTCAAATAAAAACGAGGGG + Intergenic
991949984 5:71938301-71938323 CTCCCTCAAATGAACACCTGTGG - Intergenic
992326669 5:75666590-75666612 ATGCTTGAAATTAAAAGCTTGGG - Intronic
992370452 5:76138297-76138319 GTGCTTTAAATGAAAACGTGAGG - Intronic
996239916 5:121185044-121185066 CTGGTTCAGATTCAAACCTTTGG + Intergenic
996319325 5:122196722-122196744 CTGCCACAAATTACTACCTGTGG + Intergenic
998185645 5:139977419-139977441 CTGCTCCAAATTCTAACCAGAGG + Intronic
1002533676 5:179864481-179864503 CTGCTTCTGATTAAAACCAAAGG - Intronic
1004859437 6:19786962-19786984 CTGCTTAAAAAGAAAAACTGAGG - Intergenic
1004866795 6:19860565-19860587 CTGCATAAAATTAAAACCCCTGG + Intergenic
1008599253 6:53074031-53074053 CTGCATGAAATTAAGACCTCTGG - Intronic
1012873543 6:104699083-104699105 ATGCTTCAAATTCAAACTTTTGG - Intergenic
1013010963 6:106119555-106119577 CTGCTTCCAAGGACAACCTGCGG - Intergenic
1014766421 6:125411655-125411677 CTTTTACAAATTAAAAACTGGGG - Intergenic
1015298334 6:131624706-131624728 CTCCTAGAAACTAAAACCTGAGG + Intronic
1015385119 6:132613560-132613582 GTGCTTAAAACTAAAACTTGAGG - Intergenic
1015775053 6:136805291-136805313 ATGCTTCAAAATAAAACAGGAGG + Intergenic
1016745067 6:147570567-147570589 CTTCTTCAAATTAATGTCTGGGG - Intronic
1017013727 6:150083176-150083198 GAGCTTCAAATAAAAAGCTGGGG - Intergenic
1017532713 6:155312939-155312961 CTTCTTCCAATTAAAAGATGAGG + Intronic
1018217719 6:161546606-161546628 CTTCTTCAAATTGCAAACTGTGG + Intronic
1018595034 6:165470049-165470071 CTGCTACAAAGGAATACCTGAGG + Intronic
1019462834 7:1170171-1170193 CTGTTTCAAACTAAAATTTGTGG - Intergenic
1023226370 7:37973730-37973752 CTTCCTTGAATTAAAACCTGTGG - Intronic
1024713133 7:52040337-52040359 TTTTTTTAAATTAAAACCTGGGG - Intergenic
1027705254 7:81524470-81524492 CTGCTTCAAATCTGAACCTCAGG - Intergenic
1027939429 7:84655452-84655474 TTTCTTGAAATTAAAAACTGTGG + Intergenic
1028559573 7:92159422-92159444 ATGCTTCTAATTCAACCCTGTGG + Intronic
1031492906 7:122411190-122411212 CTACTTTTTATTAAAACCTGAGG + Intronic
1032907776 7:136391480-136391502 CAGCCTCCAATTAAAACCTTGGG - Intergenic
1033845037 7:145421456-145421478 TTGCTGTAAATGAAAACCTGAGG - Intergenic
1035994997 8:4535845-4535867 CTGCTTCCAATTCAAACTTAGGG + Intronic
1036015184 8:4774989-4775011 CTGCTTTAAAGAAATACCTGAGG - Intronic
1036344709 8:7952815-7952837 CAGCTTTAACTTAAAACATGTGG + Intergenic
1036840049 8:12113582-12113604 CAGCTTTAACTTAAAACATGTGG + Exonic
1036861838 8:12359819-12359841 CAGCTTTAACTTAAAACATGTGG + Intergenic
1037129902 8:15395181-15395203 TTTCTTCAAAGTAAAACCTAGGG + Intergenic
1041601833 8:59727597-59727619 CTGTTGCCAATAAAAACCTGAGG + Intergenic
1041990058 8:63976734-63976756 CTGGTCCAAATTAAATGCTGTGG - Intergenic
1044517487 8:93156001-93156023 CTGATTTAAATTAAAAACTCAGG - Intronic
1045039189 8:98204820-98204842 CTGCTTGTAATTAATATCTGTGG - Intronic
1045046029 8:98279283-98279305 CTGCTTCCAATTACAAGCTCTGG + Intronic
1045714158 8:105022028-105022050 CTGCATCAAATTTGAACCTAAGG + Intronic
1048116299 8:131527262-131527284 CTGGTTAAAATTCAAACCTAGGG - Intergenic
1048599064 8:135899698-135899720 TTGTTTCAAATTCAAACCTCAGG - Intergenic
1048663101 8:136629753-136629775 TTTCTTAAACTTAAAACCTGTGG - Intergenic
1051866204 9:21685677-21685699 CTGCTCCAAGTTGAAACCAGTGG - Intergenic
1052221387 9:26027729-26027751 CTGCTTTAAGTGAACACCTGAGG + Intergenic
1053618605 9:39794213-39794235 CTGTTTCAAATGAATACCTCTGG + Intergenic
1054265550 9:62913216-62913238 CTGTTTCAAATGAATACCTCTGG - Intergenic
1055143059 9:72898320-72898342 CTGTTTCAAAATAAAGCCAGAGG + Intergenic
1055367620 9:75562243-75562265 CTGCTTCTAGTAAAAACCTCAGG + Intergenic
1058333453 9:103794743-103794765 CTGCTGCAAAAATAAACCTGGGG - Intergenic
1059099463 9:111455702-111455724 CAGCCCCAAATAAAAACCTGAGG + Intronic
1060765336 9:126291560-126291582 CTTTTTCAAAATAAAAGCTGTGG + Intergenic
1185674806 X:1840592-1840614 CTGCTTCTGATGAAAACCTCAGG - Intergenic
1185998358 X:4978733-4978755 CTGTTACAAATTATAGCCTGTGG - Intergenic
1186729859 X:12398147-12398169 TTTCTCAAAATTAAAACCTGAGG + Intronic
1187479996 X:19646661-19646683 CTTTTTCAAATTAAAAACTGTGG - Intronic
1187686834 X:21824226-21824248 CTGCTTCTAGTAAAAACCTCAGG + Intergenic
1188260923 X:28022940-28022962 CTCCATCAAATTAAAAACTTTGG - Intergenic
1191659322 X:63634141-63634163 TTTCTTCAAATCAAATCCTGGGG + Intergenic
1195866438 X:109437927-109437949 CTGCTTCAAATGTAAACTTGAGG - Intronic
1197159975 X:123312145-123312167 ATAGTTCAATTTAAAACCTGAGG + Intronic
1198039851 X:132839814-132839836 CCTCTTCAAATTAGAACCTCTGG + Intronic
1198114047 X:133527689-133527711 CTTTTACAAATTAAAACCTGGGG - Intergenic
1199855288 X:151754428-151754450 CTGTTTCACCTTGAAACCTGAGG - Intergenic