ID: 1077500882

View in Genome Browser
Species Human (GRCh38)
Location 11:2909346-2909368
Sequence CACGCTGCCAGGTAGGGCCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 137}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077500874_1077500882 -2 Left 1077500874 11:2909325-2909347 CCTGCCCGGAGCGCTCATGCACA 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1077500882 11:2909346-2909368 CACGCTGCCAGGTAGGGCCGGGG 0: 1
1: 0
2: 1
3: 9
4: 137
1077500873_1077500882 5 Left 1077500873 11:2909318-2909340 CCTCGCGCCTGCCCGGAGCGCTC 0: 1
1: 0
2: 1
3: 30
4: 190
Right 1077500882 11:2909346-2909368 CACGCTGCCAGGTAGGGCCGGGG 0: 1
1: 0
2: 1
3: 9
4: 137
1077500875_1077500882 -6 Left 1077500875 11:2909329-2909351 CCCGGAGCGCTCATGCACACGCT 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1077500882 11:2909346-2909368 CACGCTGCCAGGTAGGGCCGGGG 0: 1
1: 0
2: 1
3: 9
4: 137
1077500876_1077500882 -7 Left 1077500876 11:2909330-2909352 CCGGAGCGCTCATGCACACGCTG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1077500882 11:2909346-2909368 CACGCTGCCAGGTAGGGCCGGGG 0: 1
1: 0
2: 1
3: 9
4: 137
1077500869_1077500882 27 Left 1077500869 11:2909296-2909318 CCCGGGGTCTACCTGCTCTTCGC 0: 1
1: 0
2: 1
3: 6
4: 120
Right 1077500882 11:2909346-2909368 CACGCTGCCAGGTAGGGCCGGGG 0: 1
1: 0
2: 1
3: 9
4: 137
1077500870_1077500882 26 Left 1077500870 11:2909297-2909319 CCGGGGTCTACCTGCTCTTCGCC 0: 1
1: 0
2: 1
3: 5
4: 117
Right 1077500882 11:2909346-2909368 CACGCTGCCAGGTAGGGCCGGGG 0: 1
1: 0
2: 1
3: 9
4: 137
1077500871_1077500882 16 Left 1077500871 11:2909307-2909329 CCTGCTCTTCGCCTCGCGCCTGC 0: 1
1: 0
2: 1
3: 8
4: 171
Right 1077500882 11:2909346-2909368 CACGCTGCCAGGTAGGGCCGGGG 0: 1
1: 0
2: 1
3: 9
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077500882 Original CRISPR CACGCTGCCAGGTAGGGCCG GGG Exonic
900243911 1:1629140-1629162 CGCGCTGCCGGGGAGGCCCGAGG - Exonic
900395665 1:2452300-2452322 CTACCTGCCAGGCAGGGCCGGGG - Intronic
900644916 1:3704654-3704676 CAGGCTTCCAGGAAGGGCCTGGG + Intronic
902509987 1:16961185-16961207 CACCCTGCCATGTGGGGGCGGGG - Intronic
902514561 1:16983167-16983189 CAGGCTGCCATAAAGGGCCGGGG - Intergenic
902802104 1:18836947-18836969 GGGGCTGCCAGGTAGGGCGGAGG + Intergenic
905037759 1:34929191-34929213 CACGCTCCCGGTCAGGGCCGCGG - Intronic
905105873 1:35563336-35563358 CACGCTGTCAGGCAGCACCGAGG - Exonic
905414318 1:37794138-37794160 CACGCTGGGAGGTAGCGCGGCGG + Exonic
905824468 1:41018048-41018070 CACGCTGCCTGATAGGCCCCAGG - Exonic
914730354 1:150364494-150364516 CACGCTGCAAGGAGGGGCTGCGG - Intronic
915472864 1:156136226-156136248 TGCGCTGCGAGGTAGGGCTGGGG - Exonic
920222071 1:204411426-204411448 CAGTCTCTCAGGTAGGGCCGCGG + Exonic
921220663 1:212971446-212971468 CAGCCTGCCAGGTAGGGCTGTGG - Intronic
922576956 1:226667261-226667283 CAGTGTGCCAGGTAGGGCCTAGG - Intronic
1064141672 10:12795888-12795910 TATGCTGCCAGGAAGGGCTGAGG + Intronic
1064230732 10:13528323-13528345 CGGGCTGGCAGGCAGGGCCGCGG - Intronic
1065102600 10:22345626-22345648 GGTGCTGCAAGGTAGGGCCGAGG + Exonic
1065239808 10:23694469-23694491 CTCGCTTCCAGGTCGGGGCGGGG - Intergenic
1073053046 10:100681489-100681511 CACGGTGCCAGGCAGGGATGCGG + Intergenic
1073107438 10:101040282-101040304 CACGCTGTCAAGTAGGGTGGTGG - Exonic
1074942897 10:118252153-118252175 CAGGCAGCCAGGTGAGGCCGTGG + Intergenic
1076889865 10:133278110-133278132 GAGGCTCCCAGGTAGGGCTGGGG + Intergenic
1077374139 11:2197666-2197688 GACACTGCCAGGCAGGGCAGGGG + Intergenic
1077500882 11:2909346-2909368 CACGCTGCCAGGTAGGGCCGGGG + Exonic
1077584903 11:3443822-3443844 CAGGCTGCCTGGAAGGGACGCGG + Intergenic
1077760320 11:5088419-5088441 CACTGTGCCAGGTAGGGAGGAGG + Intergenic
1079486079 11:20937197-20937219 AAGGCTGCCAGGAAGGGCAGCGG - Intronic
1083655385 11:64226748-64226770 CCCACTGCCAGGTGGGGACGAGG + Exonic
1092282985 12:7111047-7111069 CACTCTGCCAGTTAGAGACGAGG - Intergenic
1092888859 12:12950280-12950302 CACGATGCCAAGTATGGCCAGGG + Exonic
1096365585 12:51026250-51026272 CTCGCTGGCAGGGAGGGGCGCGG - Intronic
1098823849 12:75268735-75268757 TAGGCTGGCAGGTAGGGCTGGGG + Intergenic
1101882298 12:108633823-108633845 CACGCTGCCAGGCACTGCTGTGG + Intronic
1103614058 12:122141176-122141198 CAGGCAGCCAGGTGGGGCCGGGG + Intronic
1104965827 12:132508444-132508466 CGCGCTGCCAGGCAGGCCCGGGG - Intronic
1104966992 12:132512772-132512794 CAGGCTGCCAGGGAGGGCTGAGG + Intronic
1105699567 13:22926338-22926360 CAGGCTTCCAGGAAGGGCCTGGG + Intergenic
1106215105 13:27690308-27690330 GACACTGCCAGGTAGGGGCTGGG - Intergenic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1121006894 14:90496331-90496353 AACTCTGCCAGGAAGGGCTGTGG - Intergenic
1125720279 15:41842023-41842045 CACTCTGCCAGGTGGAGCAGAGG - Intronic
1126042450 15:44605064-44605086 CACTCTGCCAGGTAGAGTAGAGG - Intronic
1128322134 15:66701516-66701538 CTCGCTCCAAGGGAGGGCCGTGG + Intergenic
1128997018 15:72304748-72304770 CCAGCTGCCAGTGAGGGCCGAGG - Exonic
1129710884 15:77819766-77819788 CACCCTGCCTGGCCGGGCCGCGG + Intronic
1131155980 15:90075849-90075871 CAAGATCCCAGGTGGGGCCGAGG - Intronic
1131405426 15:92160514-92160536 CCAGCTGCCAGGTTGGGCTGTGG - Intronic
1132582100 16:689596-689618 CACGCTGCCACCCAGGGCTGTGG + Exonic
1132654969 16:1037905-1037927 CAAGCTGTCAGCCAGGGCCGAGG - Intergenic
1132872485 16:2122041-2122063 CAGGCTGCCCGGTGGGGCCCGGG + Intronic
1133235857 16:4387147-4387169 GACGTAGCCAGGCAGGGCCGGGG - Intronic
1134551581 16:15141241-15141263 CAGGCTGCCTGGTGGGGCCCGGG + Intergenic
1136570398 16:31093410-31093432 CCCTCTGCCAGGTGGGGCAGGGG - Exonic
1138578283 16:57922837-57922859 AGCGCAGCCAGGTAGGGCCAGGG + Intronic
1141951040 16:87339565-87339587 CACTGTCCCAGGTAGGGCAGAGG - Intronic
1144574979 17:16423680-16423702 CAAGCTGCACGGTAGGGCAGAGG - Exonic
1147879824 17:43646299-43646321 CCCGCTGCCAGGAGGGGGCGCGG - Intronic
1149018320 17:51934283-51934305 CACACAGCCAGGTAGAGGCGAGG + Intronic
1152033393 17:77857330-77857352 CACGATGCCAGGGAGGGATGGGG + Intergenic
1152556846 17:81057573-81057595 CGTGCTACCAGGCAGGGCCGGGG - Intronic
1152573491 17:81130501-81130523 CAGGCTGCGAGGAGGGGCCGAGG - Intronic
1152898632 17:82927758-82927780 CACGCTGCCAGGGAGTCACGGGG - Intronic
1153911285 18:9708380-9708402 CTCGCAGCCAGGCAGTGCCGGGG - Exonic
1156364378 18:36412102-36412124 CACGCAGGCAGGAAGGGGCGGGG + Intronic
1160179836 18:76624524-76624546 CAAGCTCCCAGGTGAGGCCGAGG - Intergenic
1160605876 18:80049153-80049175 CCCGCTCCCAGGGAAGGCCGCGG - Intronic
1160605899 18:80049228-80049250 CCCGCTCCCAGGGAAGGCCGCGG - Intronic
1162745125 19:12793710-12793732 CGCTCTGCCGGGCAGGGCCGCGG + Intronic
1162807252 19:13144387-13144409 CAGCCTGCCAGGGAGGGCTGGGG + Exonic
1167605798 19:50480801-50480823 GAGGCCGCCAGGAAGGGCCGGGG - Intronic
928450303 2:31372333-31372355 TCCGCTGCCAGGTGGGGCAGGGG + Exonic
929574146 2:43041728-43041750 CACGCTGGCAGGGAGGGGCTTGG - Intergenic
929758575 2:44787856-44787878 CACGCTGGCAGGTAGTGGCGGGG + Intergenic
934105548 2:88691746-88691768 CCCGCTGCCCGGGAGGGCCGGGG + Exonic
934678235 2:96265265-96265287 CAGGGCGCCAGGCAGGGCCGAGG + Exonic
937364344 2:121249828-121249850 CACCCCGCCAGGTCGGGCCTAGG + Intronic
1168830891 20:844842-844864 CAGGCGGCAAGGTAGGGCGGGGG - Exonic
1175220047 20:57411654-57411676 CAGGCAGGCAGGAAGGGCCGGGG + Intergenic
1175399555 20:58692787-58692809 CGGGCTGCCGGGCAGGGCCGGGG + Exonic
1175429512 20:58891644-58891666 CACGCGGGCCGGGAGGGCCGGGG - Intronic
1175495530 20:59411621-59411643 CACCTTTCCAGGTAGGGCAGGGG + Intergenic
1175888807 20:62307026-62307048 CAGGCAGCCATGTAGGGCCAGGG - Intronic
1175892734 20:62322646-62322668 ACCGCTGCCAGGTAGGGCTGTGG - Exonic
1175999559 20:62825839-62825861 CACGCTGCCCGGGAGGCCGGCGG - Exonic
1176143702 20:63556108-63556130 CAGTCGGCCAGGAAGGGCCGTGG - Exonic
1178878396 21:36429881-36429903 CAGGCTGCCTGGAGGGGCCGAGG - Intergenic
1180735387 22:18012569-18012591 AGGGCTGCCAGATAGGGCCGGGG + Intronic
1180961883 22:19765992-19766014 CACGGAGAAAGGTAGGGCCGGGG + Exonic
1182551858 22:31104962-31104984 CACGCTGACCTGTAGGTCCGGGG - Exonic
1184296594 22:43529033-43529055 CAGGCTGCCAGGAAGGGGCTGGG + Intronic
1184470476 22:44692808-44692830 CGCCCTGCCAGGCAGGCCCGGGG - Intronic
1184651745 22:45922466-45922488 CATGCCGCCAGGTGGGGCTGGGG + Exonic
1184666029 22:45989602-45989624 CACCCTGACAGGTAGGATCGTGG - Intergenic
949461977 3:4303516-4303538 CGCCCTTCCAGGTAGGGGCGGGG + Exonic
955397172 3:58565783-58565805 CAAGCTCCCAGGTAAGGCGGAGG - Exonic
960829871 3:121835027-121835049 CACGCTGCCCCGGAAGGCCGCGG - Exonic
966390818 3:179451168-179451190 GACGCTGCCCGGGAGGGACGAGG - Intronic
969000098 4:3973665-3973687 CAGGCTGCCTGGAAGGGACGCGG + Intergenic
969115657 4:4869267-4869289 AAGGCTGCCACGTAGGGTCGGGG - Intergenic
969430059 4:7148735-7148757 CTTGCGGCCAGGTAGGGCTGTGG - Intergenic
972671476 4:41216465-41216487 GAGGCCGCCAGGTTGGGCCGAGG + Intronic
983670073 4:170226569-170226591 CACCTAGCCAGGTAGGGCAGGGG - Intergenic
985390655 4:189489047-189489069 CTCGCTGCCAGGCAGGGCAGGGG + Intergenic
996581212 5:125034471-125034493 CAAGCTGCCTGCTGGGGCCGTGG - Intergenic
997608108 5:135191287-135191309 CACGCAGCCAGGGAGGCCTGAGG + Intronic
998849368 5:146338930-146338952 CAGCCTGCCAGGAAGGGCCCGGG - Intronic
1002873741 6:1191249-1191271 CAGGCTGCCATGTAGGGCCGGGG + Intergenic
1012189098 6:96259651-96259673 CACGCTGCCATGTGGGGAAGGGG - Intergenic
1019544968 7:1569851-1569873 CACACTGCCAGGCCGGGCAGTGG + Exonic
1019652357 7:2166925-2166947 CACTCTTCCAGGAAGGGCCCCGG + Intronic
1021676953 7:23090101-23090123 TACCCTGCCTGGTAGGGCAGTGG - Intergenic
1023818991 7:43969914-43969936 CAAGGTGCCTGGTAGGGCTGAGG - Intergenic
1026833677 7:73624462-73624484 CGCGCTGGCAGGTCTGGCCGCGG - Exonic
1026848670 7:73711661-73711683 CAGGCTGCCAGGTTGGGAAGTGG + Intronic
1029240649 7:99159389-99159411 TTCGCTGCCAGGTGGGGCAGGGG + Intergenic
1029864436 7:103611619-103611641 CGAGGTGCCAGGTAAGGCCGTGG + Exonic
1030007289 7:105132032-105132054 AACGATGCCAGGCAGGGCCAGGG + Intronic
1036286693 8:7449089-7449111 CACCCTGGCAGGGAGGGACGGGG + Intronic
1036334785 8:7862434-7862456 CACCCTGGCAGGGAGGGACGGGG - Intronic
1036377140 8:8210291-8210313 CAGGCTGCCTGGAAGGGACGCGG - Intergenic
1036852409 8:12212858-12212880 CAGGCTGCCTGGAAGGGACGCGG + Intergenic
1036873777 8:12455381-12455403 CAGGCTGCCTGGAAGGGACGCGG + Intergenic
1040023601 8:42762061-42762083 CACACTTCCAGGTAGAGCCCTGG + Intronic
1046226692 8:111290584-111290606 CACGGTGCCAGGGAGGGTGGTGG + Intergenic
1047236968 8:123050635-123050657 CATGCAGCCATGTAGGGCAGGGG - Intronic
1047738629 8:127788961-127788983 GAGGCTGCCAGGTAGGGCTGGGG + Intergenic
1049273536 8:141708427-141708449 CATGCTGCCAGGCAGAGCTGAGG - Intergenic
1049643517 8:143726118-143726140 CACGCTGCCAGCCAGCGCGGAGG - Exonic
1049807924 8:144549291-144549313 GACGCTGCCAGGGAGAGACGAGG + Intronic
1049932457 9:470214-470236 CATGCGCCCAGGTAGGGGCGTGG + Intergenic
1051377575 9:16419244-16419266 TAGGCTGCCAGGGAGGGCAGGGG + Exonic
1055829484 9:80360828-80360850 CACCCTGCCAGGAAGGGAGGTGG - Intergenic
1057269819 9:93644559-93644581 CACCCTGCAAGACAGGGCCGAGG - Intronic
1059348068 9:113645766-113645788 GACCCTGCCAGGGAGGGCAGCGG + Intergenic
1059392172 9:114006142-114006164 TACGCTGCCAGGTAATTCCGTGG - Intronic
1059399639 9:114060889-114060911 CAGGGTGCCAGGCTGGGCCGAGG - Intronic
1060752623 9:126183504-126183526 GGCGCTGGCAGGGAGGGCCGCGG - Intergenic
1061428838 9:130518352-130518374 CACAATGCCAGGGAGGGCCCAGG + Intergenic
1062426110 9:136507014-136507036 CACGCGGCACGGCAGGGCCGGGG - Intronic
1062561441 9:137143923-137143945 CAAGCTGCCACGGAGTGCCGTGG - Intronic
1186583075 X:10841646-10841668 CAGGCTGCCAAGGAGGGCCACGG + Intergenic
1187428794 X:19203192-19203214 GAGGCAGCCAGGTAGGGCTGGGG - Intergenic
1191189499 X:57651273-57651295 CAGCCTGCCATGTAGGGCCCAGG - Intergenic
1198184121 X:134237333-134237355 CACGCTTCCAGGTATGTCTGCGG + Exonic
1200145283 X:153923180-153923202 CACACTGCCAGGTGGAGCCCAGG + Intronic
1200179215 X:154140388-154140410 CTCGCTGCCAGCTGGGGCCCTGG - Intergenic
1200250716 X:154552422-154552444 CACGCTGCCGGGTAGGCTCCAGG + Intronic