ID: 1077506116

View in Genome Browser
Species Human (GRCh38)
Location 11:2930688-2930710
Sequence GTAGGGCTGGTCCCAGGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077506116_1077506127 8 Left 1077506116 11:2930688-2930710 CCCAGACCTGGGACCAGCCCTAC No data
Right 1077506127 11:2930719-2930741 GCCCTTCAGGGTCACTGTAAAGG No data
1077506116_1077506122 -5 Left 1077506116 11:2930688-2930710 CCCAGACCTGGGACCAGCCCTAC No data
Right 1077506122 11:2930706-2930728 CCTACCTCCACCTGCCCTTCAGG No data
1077506116_1077506130 24 Left 1077506116 11:2930688-2930710 CCCAGACCTGGGACCAGCCCTAC No data
Right 1077506130 11:2930735-2930757 GTAAAGGATAAAGAGACGTCCGG No data
1077506116_1077506123 -4 Left 1077506116 11:2930688-2930710 CCCAGACCTGGGACCAGCCCTAC No data
Right 1077506123 11:2930707-2930729 CTACCTCCACCTGCCCTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077506116 Original CRISPR GTAGGGCTGGTCCCAGGTCT GGG (reversed) Intergenic
No off target data available for this crispr