ID: 1077506118

View in Genome Browser
Species Human (GRCh38)
Location 11:2930694-2930716
Sequence GTGGAGGTAGGGCTGGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077506118_1077506130 18 Left 1077506118 11:2930694-2930716 CCTGGGACCAGCCCTACCTCCAC No data
Right 1077506130 11:2930735-2930757 GTAAAGGATAAAGAGACGTCCGG No data
1077506118_1077506131 26 Left 1077506118 11:2930694-2930716 CCTGGGACCAGCCCTACCTCCAC No data
Right 1077506131 11:2930743-2930765 TAAAGAGACGTCCGGCTCAGAGG No data
1077506118_1077506127 2 Left 1077506118 11:2930694-2930716 CCTGGGACCAGCCCTACCTCCAC No data
Right 1077506127 11:2930719-2930741 GCCCTTCAGGGTCACTGTAAAGG No data
1077506118_1077506123 -10 Left 1077506118 11:2930694-2930716 CCTGGGACCAGCCCTACCTCCAC No data
Right 1077506123 11:2930707-2930729 CTACCTCCACCTGCCCTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077506118 Original CRISPR GTGGAGGTAGGGCTGGTCCC AGG (reversed) Intergenic
No off target data available for this crispr