ID: 1077506119

View in Genome Browser
Species Human (GRCh38)
Location 11:2930701-2930723
Sequence AGGGCAGGTGGAGGTAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077506119_1077506131 19 Left 1077506119 11:2930701-2930723 CCAGCCCTACCTCCACCTGCCCT No data
Right 1077506131 11:2930743-2930765 TAAAGAGACGTCCGGCTCAGAGG No data
1077506119_1077506127 -5 Left 1077506119 11:2930701-2930723 CCAGCCCTACCTCCACCTGCCCT No data
Right 1077506127 11:2930719-2930741 GCCCTTCAGGGTCACTGTAAAGG No data
1077506119_1077506130 11 Left 1077506119 11:2930701-2930723 CCAGCCCTACCTCCACCTGCCCT No data
Right 1077506130 11:2930735-2930757 GTAAAGGATAAAGAGACGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077506119 Original CRISPR AGGGCAGGTGGAGGTAGGGC TGG (reversed) Intergenic
No off target data available for this crispr