ID: 1077506122

View in Genome Browser
Species Human (GRCh38)
Location 11:2930706-2930728
Sequence CCTACCTCCACCTGCCCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077506116_1077506122 -5 Left 1077506116 11:2930688-2930710 CCCAGACCTGGGACCAGCCCTAC No data
Right 1077506122 11:2930706-2930728 CCTACCTCCACCTGCCCTTCAGG No data
1077506117_1077506122 -6 Left 1077506117 11:2930689-2930711 CCAGACCTGGGACCAGCCCTACC No data
Right 1077506122 11:2930706-2930728 CCTACCTCCACCTGCCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077506122 Original CRISPR CCTACCTCCACCTGCCCTTC AGG Intergenic
No off target data available for this crispr