ID: 1077506123

View in Genome Browser
Species Human (GRCh38)
Location 11:2930707-2930729
Sequence CTACCTCCACCTGCCCTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077506116_1077506123 -4 Left 1077506116 11:2930688-2930710 CCCAGACCTGGGACCAGCCCTAC No data
Right 1077506123 11:2930707-2930729 CTACCTCCACCTGCCCTTCAGGG No data
1077506118_1077506123 -10 Left 1077506118 11:2930694-2930716 CCTGGGACCAGCCCTACCTCCAC No data
Right 1077506123 11:2930707-2930729 CTACCTCCACCTGCCCTTCAGGG No data
1077506117_1077506123 -5 Left 1077506117 11:2930689-2930711 CCAGACCTGGGACCAGCCCTACC No data
Right 1077506123 11:2930707-2930729 CTACCTCCACCTGCCCTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077506123 Original CRISPR CTACCTCCACCTGCCCTTCA GGG Intergenic
No off target data available for this crispr