ID: 1077506127

View in Genome Browser
Species Human (GRCh38)
Location 11:2930719-2930741
Sequence GCCCTTCAGGGTCACTGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077506119_1077506127 -5 Left 1077506119 11:2930701-2930723 CCAGCCCTACCTCCACCTGCCCT No data
Right 1077506127 11:2930719-2930741 GCCCTTCAGGGTCACTGTAAAGG No data
1077506117_1077506127 7 Left 1077506117 11:2930689-2930711 CCAGACCTGGGACCAGCCCTACC No data
Right 1077506127 11:2930719-2930741 GCCCTTCAGGGTCACTGTAAAGG No data
1077506116_1077506127 8 Left 1077506116 11:2930688-2930710 CCCAGACCTGGGACCAGCCCTAC No data
Right 1077506127 11:2930719-2930741 GCCCTTCAGGGTCACTGTAAAGG No data
1077506118_1077506127 2 Left 1077506118 11:2930694-2930716 CCTGGGACCAGCCCTACCTCCAC No data
Right 1077506127 11:2930719-2930741 GCCCTTCAGGGTCACTGTAAAGG No data
1077506120_1077506127 -9 Left 1077506120 11:2930705-2930727 CCCTACCTCCACCTGCCCTTCAG No data
Right 1077506127 11:2930719-2930741 GCCCTTCAGGGTCACTGTAAAGG No data
1077506121_1077506127 -10 Left 1077506121 11:2930706-2930728 CCTACCTCCACCTGCCCTTCAGG No data
Right 1077506127 11:2930719-2930741 GCCCTTCAGGGTCACTGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077506127 Original CRISPR GCCCTTCAGGGTCACTGTAA AGG Intergenic
No off target data available for this crispr