ID: 1077506130

View in Genome Browser
Species Human (GRCh38)
Location 11:2930735-2930757
Sequence GTAAAGGATAAAGAGACGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077506119_1077506130 11 Left 1077506119 11:2930701-2930723 CCAGCCCTACCTCCACCTGCCCT No data
Right 1077506130 11:2930735-2930757 GTAAAGGATAAAGAGACGTCCGG No data
1077506118_1077506130 18 Left 1077506118 11:2930694-2930716 CCTGGGACCAGCCCTACCTCCAC No data
Right 1077506130 11:2930735-2930757 GTAAAGGATAAAGAGACGTCCGG No data
1077506124_1077506130 2 Left 1077506124 11:2930710-2930732 CCTCCACCTGCCCTTCAGGGTCA No data
Right 1077506130 11:2930735-2930757 GTAAAGGATAAAGAGACGTCCGG No data
1077506117_1077506130 23 Left 1077506117 11:2930689-2930711 CCAGACCTGGGACCAGCCCTACC No data
Right 1077506130 11:2930735-2930757 GTAAAGGATAAAGAGACGTCCGG No data
1077506120_1077506130 7 Left 1077506120 11:2930705-2930727 CCCTACCTCCACCTGCCCTTCAG No data
Right 1077506130 11:2930735-2930757 GTAAAGGATAAAGAGACGTCCGG No data
1077506126_1077506130 -4 Left 1077506126 11:2930716-2930738 CCTGCCCTTCAGGGTCACTGTAA No data
Right 1077506130 11:2930735-2930757 GTAAAGGATAAAGAGACGTCCGG No data
1077506128_1077506130 -8 Left 1077506128 11:2930720-2930742 CCCTTCAGGGTCACTGTAAAGGA No data
Right 1077506130 11:2930735-2930757 GTAAAGGATAAAGAGACGTCCGG No data
1077506116_1077506130 24 Left 1077506116 11:2930688-2930710 CCCAGACCTGGGACCAGCCCTAC No data
Right 1077506130 11:2930735-2930757 GTAAAGGATAAAGAGACGTCCGG No data
1077506125_1077506130 -1 Left 1077506125 11:2930713-2930735 CCACCTGCCCTTCAGGGTCACTG No data
Right 1077506130 11:2930735-2930757 GTAAAGGATAAAGAGACGTCCGG No data
1077506129_1077506130 -9 Left 1077506129 11:2930721-2930743 CCTTCAGGGTCACTGTAAAGGAT No data
Right 1077506130 11:2930735-2930757 GTAAAGGATAAAGAGACGTCCGG No data
1077506121_1077506130 6 Left 1077506121 11:2930706-2930728 CCTACCTCCACCTGCCCTTCAGG No data
Right 1077506130 11:2930735-2930757 GTAAAGGATAAAGAGACGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077506130 Original CRISPR GTAAAGGATAAAGAGACGTC CGG Intergenic
No off target data available for this crispr