ID: 1077508386

View in Genome Browser
Species Human (GRCh38)
Location 11:2942727-2942749
Sequence CAGGGTGAACAGTCACAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077508376_1077508386 18 Left 1077508376 11:2942686-2942708 CCTGACCCCAGCGCCACTGGTTT No data
Right 1077508386 11:2942727-2942749 CAGGGTGAACAGTCACAGGAAGG No data
1077508379_1077508386 11 Left 1077508379 11:2942693-2942715 CCAGCGCCACTGGTTTTGAGTCT No data
Right 1077508386 11:2942727-2942749 CAGGGTGAACAGTCACAGGAAGG No data
1077508373_1077508386 23 Left 1077508373 11:2942681-2942703 CCTGCCCTGACCCCAGCGCCACT No data
Right 1077508386 11:2942727-2942749 CAGGGTGAACAGTCACAGGAAGG No data
1077508378_1077508386 12 Left 1077508378 11:2942692-2942714 CCCAGCGCCACTGGTTTTGAGTC No data
Right 1077508386 11:2942727-2942749 CAGGGTGAACAGTCACAGGAAGG No data
1077508375_1077508386 19 Left 1077508375 11:2942685-2942707 CCCTGACCCCAGCGCCACTGGTT No data
Right 1077508386 11:2942727-2942749 CAGGGTGAACAGTCACAGGAAGG No data
1077508372_1077508386 30 Left 1077508372 11:2942674-2942696 CCAAACTCCTGCCCTGACCCCAG No data
Right 1077508386 11:2942727-2942749 CAGGGTGAACAGTCACAGGAAGG No data
1077508377_1077508386 13 Left 1077508377 11:2942691-2942713 CCCCAGCGCCACTGGTTTTGAGT No data
Right 1077508386 11:2942727-2942749 CAGGGTGAACAGTCACAGGAAGG No data
1077508380_1077508386 5 Left 1077508380 11:2942699-2942721 CCACTGGTTTTGAGTCTCAGTTC No data
Right 1077508386 11:2942727-2942749 CAGGGTGAACAGTCACAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077508386 Original CRISPR CAGGGTGAACAGTCACAGGA AGG Intergenic
No off target data available for this crispr