ID: 1077511805

View in Genome Browser
Species Human (GRCh38)
Location 11:2969443-2969465
Sequence TTCCTGTGGTGTGAGTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 246}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077511805_1077511809 -5 Left 1077511805 11:2969443-2969465 CCTGCACACTCACACCACAGGAA 0: 1
1: 0
2: 2
3: 27
4: 246
Right 1077511809 11:2969461-2969483 AGGAAGACAGAGATGGGCTCTGG 0: 1
1: 1
2: 4
3: 67
4: 551
1077511805_1077511810 9 Left 1077511805 11:2969443-2969465 CCTGCACACTCACACCACAGGAA 0: 1
1: 0
2: 2
3: 27
4: 246
Right 1077511810 11:2969475-2969497 GGGCTCTGGAATCTATTCATAGG 0: 1
1: 0
2: 1
3: 6
4: 129
1077511805_1077511811 21 Left 1077511805 11:2969443-2969465 CCTGCACACTCACACCACAGGAA 0: 1
1: 0
2: 2
3: 27
4: 246
Right 1077511811 11:2969487-2969509 CTATTCATAGGCTTTCCCACAGG 0: 1
1: 0
2: 1
3: 9
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077511805 Original CRISPR TTCCTGTGGTGTGAGTGTGC AGG (reversed) Intronic
900179839 1:1306253-1306275 TTCCAGTCGTGTGGGGGTGCTGG - Intronic
901254855 1:7814549-7814571 TTCTTGTGGAGTAAGTGTGCTGG - Intronic
901682263 1:10920131-10920153 TTGCTGTGGGGGGTGTGTGCTGG - Intergenic
903612588 1:24626932-24626954 TTTCTGTGGTAAGAGTCTGCTGG + Intergenic
904456164 1:30649492-30649514 ATCCTGTGGAGTGGTTGTGCTGG - Intergenic
905451979 1:38062796-38062818 TGCTTGTGGAGTAAGTGTGCTGG + Intergenic
907482373 1:54754177-54754199 TGCCTGTGGTGTGCGTGCCCTGG + Intergenic
907777205 1:57528889-57528911 TTCTTGTAGTGTGATTCTGCTGG - Intronic
908251073 1:62266290-62266312 AGGCAGTGGTGTGAGTGTGCAGG - Intronic
910075970 1:83279627-83279649 TTGTTGTGGTGTGAGAGTACAGG - Intergenic
910714206 1:90212986-90213008 TTCTTATGGTGTTGGTGTGCTGG + Intergenic
910793589 1:91075658-91075680 TTCTTGTGGTGTGAGTGAGCAGG - Intergenic
915101994 1:153507392-153507414 TTCCTTGGGTGTGTGTGTGGGGG - Intergenic
918462985 1:184795286-184795308 TTCATGGGCAGTGAGTGTGCAGG + Exonic
920233031 1:204482817-204482839 TTCCTGTGGTTTGAGGATTCTGG - Intronic
920634715 1:207689372-207689394 TGTGTGTGGTGTGTGTGTGCAGG + Intronic
1063247408 10:4236407-4236429 TTTGTGTGTTGTGAGTGTGTAGG + Intergenic
1064428436 10:15250988-15251010 TTCCTGGGCTGGGAATGTGCAGG - Intronic
1064615869 10:17155491-17155513 TTGCTGTGGTGTTAGAGAGCAGG - Intronic
1064655554 10:17551998-17552020 TTGTTGTGGTGTGAGGGTGGAGG + Intergenic
1065901020 10:30207952-30207974 TTCCCCTGGTGTGAGTGCCCGGG - Intergenic
1066397802 10:35043065-35043087 TTGCTGTGGTGTGAGAGTAGAGG + Intronic
1066498991 10:35971922-35971944 TTCCTGTCGTATGAGAGGGCTGG - Intergenic
1070740432 10:78899674-78899696 TTGCTGTGTTGTCAGTGTGGAGG + Intergenic
1074547436 10:114412247-114412269 TTTCTGTGGCCTGAGTGTCCTGG + Intergenic
1074874435 10:117603005-117603027 CTCCTGTGGTATGATTGTGCTGG - Intergenic
1075594400 10:123717671-123717693 TGTGTGTGGTGTGTGTGTGCAGG - Intronic
1075683140 10:124346519-124346541 ATACTGAGGTCTGAGTGTGCTGG - Intergenic
1076262749 10:129080909-129080931 TTCTTTTGGTGTGAGTCTACTGG - Intergenic
1076321828 10:129588729-129588751 ACCCTGTGATGTCAGTGTGCTGG - Intronic
1077511805 11:2969443-2969465 TTCCTGTGGTGTGAGTGTGCAGG - Intronic
1078128605 11:8593731-8593753 TTACTGTGGGGTAAGTGTGTGGG - Intronic
1086818516 11:91404632-91404654 TTACTGTGGGGTGTGTGTGTAGG - Intergenic
1086888172 11:92226511-92226533 CTCCCGGGGTGTGGGTGTGCTGG + Intergenic
1089071725 11:115705501-115705523 TTCTTGTGGTGTGATTGAGTGGG - Intergenic
1089359211 11:117875230-117875252 TATGTGTGGTGTGAGTGTGAGGG + Intronic
1089670817 11:120055905-120055927 TTCCTGGGGTGGGAGTGAGGAGG - Intergenic
1089812609 11:121144068-121144090 TTCCTGTGCCGTGAGTGTGAAGG - Intronic
1092042019 12:5393558-5393580 TTCCAGTGGTGTGTGTGTTGGGG - Intergenic
1092164218 12:6333185-6333207 GTCCTGTGGGGTGGGGGTGCAGG - Intronic
1092166840 12:6347815-6347837 CTCCTCTGGTGGGAGGGTGCTGG - Exonic
1094524560 12:31223025-31223047 TACCTGTGGTGAGTGGGTGCCGG - Intergenic
1095391686 12:41714659-41714681 TTGCTTTGGTGTCAGTGTGCAGG + Intergenic
1095490617 12:42729761-42729783 TAGCTGTGTTGTGAGGGTGCAGG + Intergenic
1097223134 12:57461909-57461931 TTTCTGGGGTGTGAGAGTTCGGG - Intronic
1101235760 12:102787694-102787716 TTCCTGAGATGGGATTGTGCTGG - Intergenic
1101490845 12:105208119-105208141 TTCCTGGTGTGTGGGTGTGTGGG - Intronic
1101652471 12:106690058-106690080 TTCCTTTGGTGTGTGTGTTGTGG + Intronic
1101891051 12:108715649-108715671 TGCCAGTGTTGTGAGTATGCGGG - Intronic
1102397898 12:112602992-112603014 TTCCTGTGATGAGGGTGTGATGG + Intronic
1102481659 12:113227892-113227914 TTCCAGGGATGTGAGTGTGGTGG + Intronic
1104554224 12:129785604-129785626 TTCATGTGGTGTTTGTGTGAGGG + Intronic
1104661816 12:130616812-130616834 TTCCTGTGGCCTGCTTGTGCTGG - Intronic
1104966490 12:132510763-132510785 TGCCTGTGGTGTGCGTGCCCTGG + Intronic
1105947520 13:25202462-25202484 TGCCTGTGGTGACAGTGTGGTGG - Intergenic
1112538049 13:100280507-100280529 TGTGTGTGGTGTGGGTGTGCAGG - Intronic
1113489051 13:110677514-110677536 TTTCTGTGGTGTGATTGTCTGGG - Intronic
1113489084 13:110677661-110677683 TTTCTGTGGTGTGATTGTCTGGG - Intronic
1113615494 13:111677641-111677663 TTTCTGTTGTGTATGTGTGCCGG - Intergenic
1113620962 13:111762543-111762565 TTTCTGTTGTGTATGTGTGCCGG - Intergenic
1113672488 13:112184445-112184467 TTTCTGTGACCTGAGTGTGCAGG - Intergenic
1113801036 13:113086336-113086358 TCGCTTTGGTGTGAATGTGCAGG + Intronic
1115190038 14:30738269-30738291 TTCCTTTGGTGAGATTCTGCTGG - Intergenic
1116575558 14:46569933-46569955 TTCTTGTAGTGTGAGTCTGATGG - Intergenic
1116875462 14:50107022-50107044 CTCCTGTGGTTTGTGAGTGCAGG + Intergenic
1117994209 14:61463270-61463292 TTCCTTTGGTGTGAGGATGGAGG - Intronic
1118947953 14:70406174-70406196 TTCCTGGTGTGTGTGTGTGGTGG - Intronic
1119723109 14:76904697-76904719 TTCCCATGGTGTGAATGTCCTGG - Intergenic
1121341817 14:93109926-93109948 TCCCTGTGGAGTGAGTGAGTGGG - Intronic
1121608441 14:95258763-95258785 TATCTGTGGTGTGTGTGTGGAGG + Intronic
1121608452 14:95258874-95258896 TATCTGTGGTGTGTGTGTGGAGG + Intronic
1122775443 14:104114914-104114936 TTGCTGTGGTGTGAGGCTGTGGG + Exonic
1124095192 15:26642662-26642684 CTGCTTTGGTGTGTGTGTGCGGG - Intronic
1124468322 15:29960710-29960732 TTCCTGTGGAGTCTGTGGGCAGG - Intronic
1126696299 15:51328959-51328981 TTCCTGGGTTGTGAGCTTGCTGG + Intronic
1127603701 15:60564558-60564580 TTCCTGTGTTCTAAGTCTGCTGG + Intronic
1128065808 15:64763790-64763812 TTCCAATGGTGTGTGTGTGTAGG + Intronic
1129049089 15:72763077-72763099 TGCTTGTGGTGCGAGTCTGCTGG - Intronic
1129102217 15:73276044-73276066 TTTCTGTTGTGTGAAAGTGCAGG + Intronic
1129881111 15:79006519-79006541 ATCCTGTGTTGTCAGTGTGTGGG - Intronic
1130840308 15:87693723-87693745 ACCCTGGGGTGGGAGTGTGCTGG - Intergenic
1132640922 16:978066-978088 TTGGTGTGGTGTATGTGTGCAGG - Intronic
1133554973 16:6897396-6897418 TTCCTTTTGTGTGTGTGTGACGG - Intronic
1134638126 16:15808185-15808207 CTTCTGTGGTGTGACTGTGAAGG + Intronic
1135845400 16:25913973-25913995 TGTATGTGGTGTGTGTGTGCAGG + Intronic
1136115138 16:28089681-28089703 TGTGTGTGGTGTGTGTGTGCGGG - Intergenic
1136745100 16:32579778-32579800 TTTCTGTTGATTGAGTGTGCTGG + Intergenic
1137491603 16:48937673-48937695 TTTCTCTGGTGTGATTGTTCAGG + Intergenic
1137575780 16:49599297-49599319 TTGCAGTGGGGTGAGTGTGCAGG - Intronic
1139217840 16:65146502-65146524 TTCCTGGGGTGTGTCTGTGAGGG - Intergenic
1139595853 16:67957885-67957907 CTGCTGTTGTGTGAGTGTCCTGG - Exonic
1142065480 16:88059935-88059957 CTCCTGGGGTGTGTGTGTGCAGG - Intronic
1203047226 16_KI270728v1_random:838987-839009 TTTCTGTTGATTGAGTGTGCTGG + Intergenic
1147616461 17:41831472-41831494 TTGCTGTGGTTTGAATGTGTTGG + Intronic
1147738417 17:42655615-42655637 TTGCTGTGGTGTGAGAGTAGAGG + Intergenic
1149664249 17:58354666-58354688 TGCCTGTGGCGTGTGTGGGCTGG - Exonic
1151373855 17:73669377-73669399 TTCCTTTTGTGTGAGTATGGTGG + Intergenic
1152164563 17:78694065-78694087 TTTCTCTGGTGTGAGCATGCAGG - Intronic
1152294766 17:79460389-79460411 TGACTGTGGTGGGAGTGTGGTGG - Intronic
1154095365 18:11409847-11409869 TTCCTCTTGTGTGTGTGTGGGGG + Intergenic
1154971848 18:21417601-21417623 TTCTTGTAGTGTGAGTCTGCTGG - Intronic
1156444532 18:37225528-37225550 TTCACGTGATGTGAGTGAGCAGG - Intronic
1157225050 18:45855142-45855164 TTCCTGTTTTGTGAGTCTGAAGG - Intronic
1157284630 18:46369361-46369383 ATCCTGGTGTGTGTGTGTGCTGG + Intronic
1158537622 18:58322601-58322623 TTGCTGTGGTGTGGGTGGGTGGG + Intronic
1160829018 19:1094235-1094257 ATCCTGTGGTGTGAGGCTGTGGG - Intronic
1160986379 19:1840872-1840894 GTCCTGTGGTGTGTGTGTCCAGG + Intronic
1161627271 19:5334609-5334631 GCCCTGGGGTGTGTGTGTGCGGG + Intronic
1163420351 19:17210609-17210631 TAGTTGTGATGTGAGTGTGCTGG - Intronic
1163768007 19:19174066-19174088 TTCCAGGGGCCTGAGTGTGCAGG + Intronic
1166089188 19:40497313-40497335 TAGCTGTGATGTGAGTGTGATGG - Intronic
1166408597 19:42541258-42541280 TTCCAGTGGTGTGGGGGTGAGGG + Intronic
1166695981 19:44851597-44851619 TTCCTGTGGTGGCAGAGTGGAGG - Intronic
1168175926 19:54627766-54627788 TTCCTGTGGTGTGAGAGTAGAGG - Intronic
925349858 2:3193191-3193213 TTCCTGTGGTCTGAGTGGCTGGG - Intronic
925835617 2:7943486-7943508 TTCCAGAGGTGAGAGTGTGGGGG + Intergenic
927931646 2:27049635-27049657 GTCCTGTGGGGTGGGTGTGCCGG - Intronic
928177955 2:29047775-29047797 TTCCTGTGGAGTGAGCTTCCTGG + Intronic
929573808 2:43039858-43039880 TTGCTGTGGTGTGTGTGGGAGGG - Intergenic
930689694 2:54348022-54348044 TTTCTGTAGTGTGATTGTACTGG + Intronic
931642790 2:64396337-64396359 ATCCTATGGACTGAGTGTGCGGG - Intergenic
931674395 2:64679551-64679573 TTACTGTGGTGTGGGTGTTGGGG + Intronic
933099553 2:78235955-78235977 TTCCTTTAGTGTGGGTCTGCTGG + Intergenic
934557743 2:95296403-95296425 CTCCTGGGGTGTGAGGGTGAAGG - Intergenic
934907934 2:98222015-98222037 ATGCTGTTGTGTGAGTGTGGAGG - Intronic
936251681 2:110872783-110872805 ATCCTTTGGTGTGTGAGTGCTGG + Intronic
937767905 2:125683073-125683095 TGTGTGTGGTGTGTGTGTGCAGG - Intergenic
938381556 2:130839041-130839063 TTCCTGTGGTGTGCATGGGGAGG - Intronic
940091643 2:149926254-149926276 GTCCTGTGGTGTGAGGAAGCAGG + Intergenic
940461427 2:153967934-153967956 TTACTTTGCTGTGAGTGAGCTGG + Intronic
941344593 2:164352036-164352058 TTCTTATTGTGTGAGTTTGCTGG + Intergenic
942147315 2:173039578-173039600 TCCCTGTGGTTGGAGTGTGGAGG - Intronic
942525606 2:176849610-176849632 GTGATGTGGAGTGAGTGTGCAGG + Intergenic
942672951 2:178396026-178396048 TTGATGTGGTGTGATTGTGCTGG + Intronic
943338529 2:186648294-186648316 TTCCTGTGGAGGGAGTGGGATGG - Intronic
945104108 2:206292007-206292029 TTCCTTTAGTGAGAGTCTGCTGG - Intronic
946534128 2:220607965-220607987 TCCATGTGGTGTGAGCCTGCAGG - Intergenic
947170646 2:227307804-227307826 TTGCTGTGGTTTGACTGTGTCGG - Exonic
947768666 2:232653866-232653888 TTCCTTTGGAGAGAATGTGCTGG - Intronic
947861706 2:233364284-233364306 TTCCTTTAGTGTGGGTCTGCTGG - Intronic
948001354 2:234570402-234570424 TTCCTGTGGTTTGGGTGGGCTGG - Intergenic
948373378 2:237504804-237504826 TTCCTGTGTTGTTAGGGTGACGG + Intronic
948376777 2:237525920-237525942 TTCCTTTGGCGTGATTGTCCGGG + Intronic
948989555 2:241546465-241546487 TACGTGTGGTGTGCGTGTGTAGG - Intergenic
1171149627 20:22815729-22815751 TTCCTGTGGAGGGAGGATGCTGG - Intergenic
1171948044 20:31396034-31396056 TTCCTGAGGCTTGAGTGTGGGGG - Intergenic
1172190413 20:33058979-33059001 TTGCATTTGTGTGAGTGTGCAGG + Intronic
1172904104 20:38356105-38356127 TGTGTGTGGTGTGTGTGTGCTGG - Intronic
1177016624 21:15797569-15797591 TTCCTTTGGTGTGGGTGTGCTGG - Intronic
1178289446 21:31354465-31354487 TTCGTGTGGTGGGGGTGTGGAGG - Intronic
1178759921 21:35392569-35392591 ACCGTGTGGTGTGAGTGTGCAGG + Intronic
1178899822 21:36589758-36589780 TTCCTATGGAGTGAGTTTCCAGG - Intergenic
1179814865 21:43899133-43899155 TTCCTCTGGTTAGAGTGTGCTGG + Intronic
1179960557 21:44765033-44765055 TCCCTGTGGTGGGCGTGTCCAGG - Intergenic
1182253776 22:29023318-29023340 TTCCTGAGGTCAGAGTGTGCTGG - Intronic
1183368753 22:37420508-37420530 TTCCTGTGGAGCGAGGGCGCTGG - Intronic
1183582045 22:38731925-38731947 TGCCTGGGGTGGGACTGTGCAGG + Exonic
1183919478 22:41153284-41153306 TACCTGAGGAGTGAGTCTGCTGG + Intronic
1184457408 22:44618915-44618937 GGCCTGTGGAGTGAGTGTGTGGG + Intergenic
949681904 3:6523658-6523680 TTCCTGGGGTGTGGGTTTCCTGG + Intergenic
950501219 3:13365161-13365183 TTCCTCTGGGGTGGGTGTGAAGG - Intronic
950764162 3:15260985-15261007 TTCCTTTGGTGTGAATATGGTGG - Intronic
950950510 3:16993336-16993358 TTCCTGTGGTTTGCAGGTGCTGG + Intronic
953849400 3:46454677-46454699 TTCCTCAGGACTGAGTGTGCAGG + Intronic
954538652 3:51379691-51379713 TTCCTGTGGTGGGGGTGTTTTGG - Intronic
955057790 3:55471793-55471815 TCCACGTGGTGTGAGTGTGCTGG + Intronic
957226099 3:77448926-77448948 TTCATTTGGTGTGATTGTGTTGG + Intronic
960708628 3:120505530-120505552 TTCCTGGTGTGTGTGTGTGGTGG - Intergenic
961523836 3:127484133-127484155 GGCCTGCGGTGTGAGTGCGCTGG + Intergenic
961776983 3:129294788-129294810 TTCTTGTAGTGTGGGTCTGCTGG + Intronic
962256986 3:133878508-133878530 TTCTTGATGTGAGAGTGTGCTGG - Intronic
964659979 3:159109645-159109667 TTTCTTTGGTGTGGGTGTGTGGG + Intronic
964711128 3:159672953-159672975 TTCCTGTGGTGTGAATAGGGAGG - Intronic
965102639 3:164321038-164321060 TTCCTGAGGTGTGAGTATGTAGG - Intergenic
967473860 3:189892890-189892912 TTCCTATGGTGTGAATTTTCAGG - Intronic
968342708 3:197970936-197970958 TTCCTGTAGTGTAGGTCTGCTGG + Intronic
968595944 4:1484922-1484944 TTCCTGTAGTGTGAATCTCCTGG + Intergenic
970345480 4:15148618-15148640 TTCCTGTGGTGTGTGTTTTTGGG - Intergenic
972539644 4:40028224-40028246 TTCAAGTGCTGTGAGTTTGCGGG + Intergenic
972606938 4:40622384-40622406 GCCCTGTGGTATGAATGTGCTGG + Intronic
975261373 4:72303515-72303537 TTCTTGTGGTGTGGGTGTATTGG - Intronic
975588972 4:75981075-75981097 ATCCTGTAGGGTTAGTGTGCTGG + Intronic
976689667 4:87855605-87855627 TTCCTTTGGCTAGAGTGTGCAGG - Intergenic
977135615 4:93300113-93300135 TTCCTTTTGTGTGTGTGTGATGG + Intronic
979382991 4:120030509-120030531 TACTTGGGGAGTGAGTGTGCAGG - Intergenic
981006535 4:139880866-139880888 TTCCTGTATTGTGATTGTACTGG - Intronic
981548245 4:145916296-145916318 TTCATGTGGTAGAAGTGTGCAGG - Intronic
985821958 5:2166546-2166568 TGACTGTGGTGGGAGTGTGGGGG + Intergenic
985877838 5:2613551-2613573 TTCCGGGGGTTTGACTGTGCAGG - Intergenic
986657931 5:10033682-10033704 CTCCTTTGGTGTGTGTGTCCTGG - Intergenic
986697696 5:10373399-10373421 TTCCTGTGGTGAGTGTGCCCTGG + Intronic
987302622 5:16609993-16610015 TTCCTGTTCAGTGAGTGTGGAGG + Intronic
988049999 5:26015516-26015538 TTCCTGGGGTGTGTTTGTGAGGG + Intergenic
988447179 5:31300682-31300704 TTCCTGTGGTACCAGGGTGCGGG - Intronic
989025064 5:37058351-37058373 TTTGTGTGGTGTGTGTGTGTGGG - Intronic
989335269 5:40308987-40309009 TCCCTGTGGTGTGAGTCCTCAGG + Intergenic
990344517 5:54858350-54858372 TCCCTCTGGTATGAGTTTGCAGG - Intergenic
992147767 5:73869198-73869220 TTCCTGAGGAGTGTGTGTGTGGG + Intronic
992735926 5:79720825-79720847 TTCCTCTGGTGTGAATCTTCTGG - Intronic
994570848 5:101511873-101511895 TGCCTGTGCTGTCAGTGTGCTGG + Intergenic
995285278 5:110381435-110381457 TTCCCTTGGTGTCAGTGTTCTGG + Intronic
995380937 5:111532541-111532563 TTCTTGTTGTCTGGGTGTGCAGG - Intergenic
997645933 5:135481993-135482015 TTTGTGGGGTATGAGTGTGCAGG + Intergenic
999142574 5:149372134-149372156 TTTCTGTGGGGTGAGGGTGTGGG - Intronic
1000912982 5:167044747-167044769 TTCCTGTGGCTTGAGTCTTCTGG - Intergenic
1002584986 5:180239363-180239385 ATCCTGGGGTGTGGGAGTGCCGG - Intronic
1002783544 6:384487-384509 GTCCTGGGGTCTGAGAGTGCTGG + Intergenic
1004286887 6:14329493-14329515 TGTGTGTGGTGTGTGTGTGCAGG - Intergenic
1006022755 6:31126975-31126997 GTCCTGCGGAGTGAGTGTGAGGG + Intronic
1006255210 6:32827271-32827293 TTTCAGTGGTGGGAGTGGGCAGG + Intronic
1008091920 6:47302550-47302572 TTCCTATGGTGTGACTCTGACGG - Intronic
1009732979 6:67634313-67634335 TTCATGTGGTTTGGGTCTGCAGG + Intergenic
1009811462 6:68672938-68672960 TTCCTGTGGTCTGAAGATGCAGG - Intronic
1010667374 6:78646406-78646428 TTCCTGTGGTGTATGTGTCCAGG + Intergenic
1018022171 6:159771712-159771734 TTCTTGTAGTGTAGGTGTGCAGG - Intronic
1018069626 6:160152374-160152396 TTCCTGTAGTATAAGTCTGCTGG - Intronic
1018478812 6:164169605-164169627 TTCCCGTGCTGTAAGTGTGTAGG + Intergenic
1018615100 6:165679558-165679580 TTCCTGTGCTGTGACAGTGTGGG - Intronic
1021442500 7:20692458-20692480 TTCTTGTAGTGTAGGTGTGCTGG - Intronic
1021602585 7:22378979-22379001 TTCCTGTGGTAGGAGTGAGGAGG - Intergenic
1022487262 7:30789249-30789271 TACCTGTGGTGTGAGGGAGATGG + Intronic
1023654351 7:42404825-42404847 ATCCTGTGGTTTGAGGGTGTGGG - Intergenic
1023657051 7:42434253-42434275 TTCCTGTGGTGTGATCGCTCTGG + Intergenic
1024134265 7:46390536-46390558 TGCCTGTGATGAGAATGTGCAGG + Intergenic
1024524167 7:50334336-50334358 TACATGTGTTGTGTGTGTGCAGG + Intronic
1024919521 7:54543055-54543077 GTCGTGTGGTGTGTGTGTGTGGG + Intronic
1025993174 7:66511461-66511483 TGCCTGTGGGGAGAGTGGGCTGG + Intergenic
1026479361 7:70764888-70764910 TTGGGGTGATGTGAGTGTGCGGG - Exonic
1027049098 7:75010422-75010444 CTCCTGGGGTGTGTGTGTGCAGG + Intronic
1027293686 7:76744490-76744512 TTGTTGTGGTGTGAGAGTACAGG - Intergenic
1027564584 7:79776009-79776031 TTGCTGTGGTGTGAGGGTAGAGG - Intergenic
1028428310 7:90716253-90716275 CTCCTTTGGTGTGGGTGTGAGGG - Intronic
1028863832 7:95684672-95684694 TTCCTGTCGTGTGAGTTTGGAGG - Intergenic
1030272568 7:107686087-107686109 TCTCTGTGGTGTGTGTGTGTGGG + Intronic
1031920287 7:127595379-127595401 TACCTGCTGTGTGAGTGTGATGG + Exonic
1032486566 7:132292080-132292102 TTCCTGGGGGCTGAGTGTGGGGG - Intronic
1033552918 7:142463753-142463775 TTCCTATGCCCTGAGTGTGCCGG + Intergenic
1035820042 8:2580869-2580891 CGCTTGTGGTGGGAGTGTGCAGG + Intergenic
1036956123 8:13190310-13190332 TGCCTCTGGTGTGAGCTTGCTGG + Intronic
1037363059 8:18094461-18094483 TTCAGGTGTTGTCAGTGTGCTGG + Intergenic
1037732244 8:21536425-21536447 TTCTTGTGGTGTGGGTCTGTTGG - Intergenic
1038624669 8:29179524-29179546 TTCCTTTAGTGGGAGTGGGCAGG + Intronic
1040887029 8:52276020-52276042 TGCATGTGGTGTGTGTGTGGGGG - Intronic
1042206151 8:66331901-66331923 TTCCTCTGGAGTGGGGGTGCAGG - Intergenic
1043133416 8:76490330-76490352 TTCCTGGGTCTTGAGTGTGCTGG - Intergenic
1049968761 9:802704-802726 TCCCCTTGGTGTGAGTGAGCCGG + Intergenic
1049969648 9:810614-810636 TTCTTGTGGGTGGAGTGTGCTGG - Intergenic
1049995373 9:1029236-1029258 TTCCTGTGGTTGCTGTGTGCAGG + Intergenic
1052647516 9:31254795-31254817 TTCCTTTGGTGTGTGTGTGGAGG - Intergenic
1052662327 9:31449809-31449831 TGCCTGTGGTGTGTGTGTGTGGG - Intergenic
1056268792 9:84925908-84925930 TGCCTGTGGAGTGTGTGAGCTGG + Intronic
1056329871 9:85512280-85512302 TTCCTGTGGGCTGACTGGGCTGG - Intergenic
1057223332 9:93269696-93269718 TTCCTGTGATGTAGGGGTGCAGG + Intronic
1057255941 9:93547114-93547136 TTGCTGCAGTGTGAGGGTGCAGG + Intronic
1057959458 9:99440474-99440496 TTCCTGTGGTGTGATGTTGTTGG + Intergenic
1059891618 9:118810934-118810956 TTCTTGTGGTGTGAGAGTAGAGG - Intergenic
1060307543 9:122429110-122429132 TTCCTGTAGTGTGGGTCTGGTGG + Intergenic
1061131872 9:128713032-128713054 TCCCTGTGGGGAGAGTGAGCGGG - Exonic
1061721902 9:132557119-132557141 ATCCTGGGGTGTGTGTGTGCAGG + Intronic
1062123563 9:134847556-134847578 TGCCTGTGTGGTGTGTGTGCTGG + Intergenic
1185488664 X:501723-501745 TTACTGTGGTTTGTGTGTGTTGG - Intergenic
1186526972 X:10257752-10257774 TTCCTTTGGTGTGTGTGTGGGGG - Intergenic
1189584669 X:42446332-42446354 TTCTTGTAGGGTGAGTTTGCTGG - Intergenic
1190217551 X:48490022-48490044 TTCCTGAGATGTGTTTGTGCAGG - Intergenic
1190288602 X:48976701-48976723 TTCCTGTGGGGTGACTGGGCTGG + Intronic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1190581183 X:51894180-51894202 TGACTGTGGTCTGACTGTGCGGG - Intronic
1191080088 X:56501104-56501126 TTCCTGTGGTGTTCCTGTGCGGG - Intergenic
1194947640 X:100088230-100088252 TTTTTTTGGTGTGAGTCTGCTGG - Intergenic
1195668573 X:107451005-107451027 GGGCTGTGGTGTGTGTGTGCAGG - Intergenic
1196609414 X:117694845-117694867 TTGCAGTGGTGTGTGTGTGGGGG - Intergenic
1199332479 X:146578829-146578851 TTCCTGTTGTGAAATTGTGCTGG - Intergenic
1199692404 X:150318599-150318621 TTTCTGTGGTGTGAGGATACTGG - Intergenic
1200150428 X:153948819-153948841 TTCCTGTGGGGTCACTGAGCAGG + Exonic
1200338148 X:155374098-155374120 TTCCTCTGGTGTGATTCGGCAGG - Intergenic
1200348321 X:155466594-155466616 TTCCTCTGGTGTGATTCGGCAGG + Intergenic