ID: 1077515256

View in Genome Browser
Species Human (GRCh38)
Location 11:2997690-2997712
Sequence CCCTTAGCTGGCATCTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077515250_1077515256 -10 Left 1077515250 11:2997677-2997699 CCTGGTGCTTCTTCCCTTAGCTG No data
Right 1077515256 11:2997690-2997712 CCCTTAGCTGGCATCTTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077515256 Original CRISPR CCCTTAGCTGGCATCTTTGG GGG Intergenic
No off target data available for this crispr