ID: 1077515948

View in Genome Browser
Species Human (GRCh38)
Location 11:3002343-3002365
Sequence GTGCAGGGAAGGCCTGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 566
Summary {0: 1, 1: 0, 2: 4, 3: 55, 4: 506}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077515948_1077515961 8 Left 1077515948 11:3002343-3002365 CCTTGGCCAGGCCTTCCCTGCAC 0: 1
1: 0
2: 4
3: 55
4: 506
Right 1077515961 11:3002374-3002396 AGAAGGGCCTGGCAGGCCTTGGG 0: 1
1: 0
2: 6
3: 32
4: 327
1077515948_1077515967 27 Left 1077515948 11:3002343-3002365 CCTTGGCCAGGCCTTCCCTGCAC 0: 1
1: 0
2: 4
3: 55
4: 506
Right 1077515967 11:3002393-3002415 TGGGTGGTGGAGGCAGAAAGCGG 0: 1
1: 0
2: 5
3: 101
4: 824
1077515948_1077515959 1 Left 1077515948 11:3002343-3002365 CCTTGGCCAGGCCTTCCCTGCAC 0: 1
1: 0
2: 4
3: 55
4: 506
Right 1077515959 11:3002367-3002389 CCATGTGAGAAGGGCCTGGCAGG 0: 1
1: 0
2: 3
3: 42
4: 285
1077515948_1077515962 11 Left 1077515948 11:3002343-3002365 CCTTGGCCAGGCCTTCCCTGCAC 0: 1
1: 0
2: 4
3: 55
4: 506
Right 1077515962 11:3002377-3002399 AGGGCCTGGCAGGCCTTGGGTGG 0: 1
1: 0
2: 3
3: 84
4: 910
1077515948_1077515963 14 Left 1077515948 11:3002343-3002365 CCTTGGCCAGGCCTTCCCTGCAC 0: 1
1: 0
2: 4
3: 55
4: 506
Right 1077515963 11:3002380-3002402 GCCTGGCAGGCCTTGGGTGGTGG 0: 1
1: 0
2: 3
3: 50
4: 502
1077515948_1077515965 17 Left 1077515948 11:3002343-3002365 CCTTGGCCAGGCCTTCCCTGCAC 0: 1
1: 0
2: 4
3: 55
4: 506
Right 1077515965 11:3002383-3002405 TGGCAGGCCTTGGGTGGTGGAGG 0: 1
1: 0
2: 3
3: 64
4: 611
1077515948_1077515955 -3 Left 1077515948 11:3002343-3002365 CCTTGGCCAGGCCTTCCCTGCAC 0: 1
1: 0
2: 4
3: 55
4: 506
Right 1077515955 11:3002363-3002385 CACCCCATGTGAGAAGGGCCTGG 0: 1
1: 0
2: 0
3: 20
4: 217
1077515948_1077515960 7 Left 1077515948 11:3002343-3002365 CCTTGGCCAGGCCTTCCCTGCAC 0: 1
1: 0
2: 4
3: 55
4: 506
Right 1077515960 11:3002373-3002395 GAGAAGGGCCTGGCAGGCCTTGG 0: 1
1: 0
2: 12
3: 47
4: 539
1077515948_1077515953 -8 Left 1077515948 11:3002343-3002365 CCTTGGCCAGGCCTTCCCTGCAC 0: 1
1: 0
2: 4
3: 55
4: 506
Right 1077515953 11:3002358-3002380 CCCTGCACCCCATGTGAGAAGGG 0: 1
1: 0
2: 2
3: 14
4: 143
1077515948_1077515951 -9 Left 1077515948 11:3002343-3002365 CCTTGGCCAGGCCTTCCCTGCAC 0: 1
1: 0
2: 4
3: 55
4: 506
Right 1077515951 11:3002357-3002379 TCCCTGCACCCCATGTGAGAAGG 0: 1
1: 0
2: 1
3: 7
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077515948 Original CRISPR GTGCAGGGAAGGCCTGGCCA AGG (reversed) Intronic
900100773 1:961108-961130 GCGCAGCGGAGGCCTGGACACGG + Intronic
900186053 1:1333777-1333799 GGGCAGGGCTGGGCTGGCCAGGG - Exonic
900299330 1:1969211-1969233 GGGCAGGGCAGGGCTGGGCAGGG - Intronic
900299359 1:1969281-1969303 GGGCTGGGAAGGCCTGGGCTGGG - Intronic
900299374 1:1969326-1969348 GGGCAGGGCAGGGCTGGGCAAGG - Intronic
900361199 1:2289874-2289896 GGGAAGGGGTGGCCTGGCCAGGG + Intronic
900369099 1:2323612-2323634 GTGCAGCGAGGGCCTGGAGAAGG - Intronic
900376283 1:2356220-2356242 GTGGTGGGAAGGGCTGGGCAGGG + Intronic
900624661 1:3602711-3602733 GTGCCGTGGAGGCCTGGCCACGG - Intronic
900636741 1:3669660-3669682 GTGCCGGGGAGGCCGGGGCATGG - Intronic
901177389 1:7314364-7314386 GTCCAGGGAGGGCCTTGCAATGG + Intronic
902202255 1:14842456-14842478 CTGCAGGGAGGCCCTGGGCAGGG + Intronic
902415534 1:16236722-16236744 GGGCACGGGAGGTCTGGCCATGG + Exonic
902599576 1:17531947-17531969 GTGGCAGGAGGGCCTGGCCATGG - Intergenic
902671928 1:17980512-17980534 TTGCAGGGAAGGCGGGGCCTGGG + Intergenic
902700672 1:18169764-18169786 GTGCGGGGAAGGACTGTCCTTGG + Intronic
902813158 1:18901146-18901168 GTGCAGGGAAGGCCTGCAAACGG + Intronic
902910910 1:19596755-19596777 GAGGAGGAAAGGCCTGGTCACGG + Intergenic
903211071 1:21818921-21818943 GTGGAGGGGAGGCGGGGCCAGGG - Intronic
903458568 1:23505158-23505180 GTGCTGGGAAAGGGTGGCCAGGG + Intergenic
903548579 1:24142258-24142280 GAGCAAGGAGGGCCTGGCCGAGG + Intronic
904492490 1:30869732-30869754 GGGCAGGGAAGGCCTGGGGGAGG + Intronic
904575705 1:31503911-31503933 GGGCAGGGAAGGGCAGGGCAGGG - Intergenic
904661890 1:32091635-32091657 GGTGAGGGAAGGCCTGCCCATGG - Intronic
905029009 1:34869004-34869026 GGGCCTGGCAGGCCTGGCCACGG - Exonic
905199541 1:36306750-36306772 GTGCAGGTGAGGCCGAGCCAGGG + Exonic
905362728 1:37431445-37431467 GCCCTGGGGAGGCCTGGCCAAGG + Intergenic
905387150 1:37612960-37612982 GTGCAGGGAGGCCCTGGGCATGG + Intronic
905866731 1:41380945-41380967 TTGCTGGGAGGGCCTGGCCAGGG - Intronic
905891160 1:41519207-41519229 GTTCAGGGAAGGCCTGGGCAAGG + Intronic
906383406 1:45347121-45347143 GTGCAGGGGAGGCAGGGGCAGGG - Intronic
907914662 1:58857770-58857792 GTGAGGGGAAGGCATGGTCATGG + Intergenic
912321361 1:108716557-108716579 GTTCAAGGAATGTCTGGCCAGGG + Intronic
912706558 1:111919362-111919384 GTTCAGGGAAGGCCTCTCCAAGG + Intronic
912775129 1:112502087-112502109 GCTCAGGCCAGGCCTGGCCAGGG - Intronic
913229337 1:116728777-116728799 GCTCAGGGAAGGCAGGGCCAAGG - Intergenic
915482943 1:156199609-156199631 GAGTAAGGAAGGCCTGGCCAAGG + Intronic
915561974 1:156692887-156692909 GAGGTGGGAAGCCCTGGCCAGGG + Intergenic
915609559 1:156980367-156980389 GTGCAGGGCACTCCTGGCCTTGG - Intronic
915822776 1:159042907-159042929 GGGCAGGGAAGGTATGGGCAGGG + Intronic
915823139 1:159047064-159047086 GGGCAGGGAAGGTATGGGCAGGG + Intronic
917669625 1:177261004-177261026 GTTTAGGGAAGACCTGTCCAAGG + Intronic
919822615 1:201482474-201482496 GTTCAGGGAATGCCAGCCCAGGG - Intergenic
920729818 1:208472978-208473000 GAGAAGTGAAGGCCAGGCCAAGG - Intergenic
922534742 1:226371508-226371530 GTACAGGGAAGCCCATGCCAGGG - Intronic
922782467 1:228264034-228264056 GGGGAGAGAAGGCCTGGGCAGGG - Intronic
924740102 1:246789949-246789971 GTGGAGGGAGGGCCTGGCTCTGG - Intergenic
1063268634 10:4482455-4482477 GAGCAGTCAATGCCTGGCCAAGG + Intergenic
1064785234 10:18887782-18887804 ATGCAGGGCAGGGCAGGCCATGG - Intergenic
1065189247 10:23195239-23195261 GTGCGGCGCAGGCCTGGCCCAGG + Intergenic
1065278031 10:24105926-24105948 AGGCAGGGAAGGCCTTCCCAGGG + Intronic
1068157819 10:53223469-53223491 CTGCAGGGGAGGCTTGGCCAGGG - Intergenic
1068717536 10:60204914-60204936 GTGCAGGATTTGCCTGGCCAAGG + Intronic
1069694674 10:70377755-70377777 GGGCAGGCAAGGCCAAGCCAGGG + Intronic
1070519302 10:77238007-77238029 GTGCAGGGAAGGCGAGGCAGTGG - Intronic
1070751300 10:78965422-78965444 CTGCAGGGAAAGGCTGGCCCCGG + Intergenic
1070830400 10:79414749-79414771 ATCCAGGGTGGGCCTGGCCAAGG - Intronic
1072980792 10:100095427-100095449 GAGCAGGGCAGGCCTGGCTCAGG + Intergenic
1073288214 10:102400882-102400904 GTGAAGGGGGGGGCTGGCCAAGG + Intronic
1073456167 10:103637990-103638012 GACCAGGGGAGGCCTGGCCGAGG - Intronic
1074289556 10:112128118-112128140 GGGCAGGGAAGGCGTAGACACGG - Intergenic
1074585220 10:114761810-114761832 ATGGAGGGAAGGCCTTTCCAAGG - Intergenic
1075003865 10:118816963-118816985 GTGAAGGTAATGCTTGGCCAGGG - Intergenic
1075004192 10:118818716-118818738 CTCCCGGGAAGGCCTGGGCACGG - Intergenic
1075619329 10:123914293-123914315 AGGCAGAGAAGGCCTGGTCAGGG - Intronic
1076506129 10:130973665-130973687 GGGCAGGGAAAGCCTCTCCATGG + Intergenic
1076570881 10:131432187-131432209 GTGCTGGGAAGGCGCTGCCAGGG + Intergenic
1076604418 10:131680150-131680172 GTGCAGGTATGGACTGGCCTTGG + Intergenic
1076608020 10:131701894-131701916 GGGCAGGGAAGGTCTGCACAGGG - Intergenic
1076906909 10:133366994-133367016 CTGCAGGGAGGGGCTGGTCATGG + Intronic
1077431551 11:2518271-2518293 TGGCAGGGAAGCCCAGGCCAGGG + Intronic
1077515948 11:3002343-3002365 GTGCAGGGAAGGCCTGGCCAAGG - Intronic
1077823261 11:5773897-5773919 GTGTAGTGAAGGTCTGGGCATGG - Intronic
1078342086 11:10504857-10504879 GATCAGGGAAGGCCTCTCCAAGG - Intronic
1078414422 11:11153683-11153705 ACTCAGGGAAGGCCTGGCCTTGG + Intergenic
1078774443 11:14381418-14381440 CTGCCAGGACGGCCTGGCCAGGG - Intergenic
1079673906 11:23202061-23202083 TAGCAGGGGAGGCATGGCCAGGG + Intergenic
1080264673 11:30388416-30388438 GTGCTGGGAAGGCCTGCCTTAGG + Intronic
1080948142 11:36998161-36998183 GTGAAGGGCAAGCCTGGCCCAGG - Intergenic
1081672756 11:44950777-44950799 GTGCAGGGCAGGGCAGGGCAGGG + Intronic
1081673591 11:44955445-44955467 AAGCAGGAAAGGGCTGGCCATGG - Intergenic
1083203463 11:61133539-61133561 GCGTAGGGTAGGCTTGGCCAAGG - Intronic
1083624040 11:64062870-64062892 GGGCTGGGAAGGACTGGCCTAGG - Intronic
1083691289 11:64410417-64410439 GTGGAAGAAAGGTCTGGCCATGG + Intergenic
1083843376 11:65316939-65316961 GTGCGGGGAGGACCTGGCCCAGG + Intronic
1083953271 11:65968572-65968594 GTGCAGGGAAGACCTTTCCAAGG + Intronic
1084648026 11:70472060-70472082 ATGGAGGGGAGACCTGGCCAAGG - Intronic
1084892482 11:72243499-72243521 GTGAGGGGAAGGCCTGGTAAGGG + Intronic
1084893632 11:72249996-72250018 GTTCAGGGAAGGCTGGGCCCTGG + Intergenic
1085340184 11:75726228-75726250 GGGCAATGAAGGCCTGGCGAGGG + Intronic
1085472638 11:76768007-76768029 GTCCAGGCCTGGCCTGGCCAGGG - Intergenic
1086336985 11:85810524-85810546 GTGTTGGGAAGGGCCGGCCAGGG - Intronic
1087165367 11:94998035-94998057 GCGCCTGGAACGCCTGGCCAGGG + Exonic
1087170969 11:95050075-95050097 GCGCCTGGAATGCCTGGCCAGGG + Intergenic
1089001142 11:115053488-115053510 GTGAAGGGTAGGGCTGGCCAGGG - Intergenic
1089066405 11:115665478-115665500 GTGCACTGATGGCCTGGCCTCGG + Intergenic
1089140529 11:116280469-116280491 GTGTTGGGAAGGCCTGGAGAAGG - Intergenic
1089255220 11:117190475-117190497 GTGCAGGGGTGGGCTGGCCTGGG - Intronic
1089573229 11:119423368-119423390 GTGGCTGGCAGGCCTGGCCAGGG + Exonic
1089643293 11:119861508-119861530 GTGGAGGGATGGCCAGGTCAGGG - Intergenic
1089970749 11:122691205-122691227 CTGCAGGAAAGGCCCGGCAAAGG - Intronic
1091461788 12:648599-648621 GTCCAGGAAAGGCCTGGACAAGG + Intronic
1091837520 12:3596088-3596110 GTCCATGGAGGGCCTGGCTAAGG - Intergenic
1092140048 12:6177676-6177698 GTGCAGGTCAGGGCTGGGCACGG - Intergenic
1092230317 12:6772486-6772508 GTGGAGGGAAGGCCGGGCACAGG + Intergenic
1093687545 12:22073847-22073869 GTGCAGGGACTGCATGGACAAGG + Intronic
1096557927 12:52415152-52415174 GGGCAGGGACAGCCAGGCCAGGG + Intergenic
1096749056 12:53747366-53747388 GTGCAGGGAGGGGAGGGCCAAGG - Intergenic
1097048721 12:56207420-56207442 ATGGAGGGAAAGCCTGCCCAAGG - Intronic
1099428737 12:82554911-82554933 GTGCAGGCAGTGCTTGGCCAGGG - Intergenic
1100372002 12:93976915-93976937 GCCAAGGGAAGGCTTGGCCAAGG - Intergenic
1101044871 12:100794689-100794711 GTGCAGGGGAGGCATGGTCGGGG - Intronic
1103015867 12:117494130-117494152 TGGAAGGGAAGGTCTGGCCATGG - Intronic
1104955859 12:132465518-132465540 TTGCAGGGGAGGCCAGGGCAAGG + Intergenic
1104977496 12:132558774-132558796 GGGCTTGGAAGGCCTGGCCCCGG - Intronic
1104980791 12:132572379-132572401 GTGCACGCAGGTCCTGGCCACGG + Intronic
1105295888 13:19087720-19087742 GTGCAGGGAGGGCCTCAGCAAGG - Intergenic
1106132445 13:26951557-26951579 GTTCCAGGAAGGCCTGGCCCAGG + Intergenic
1106540915 13:30689755-30689777 GTGCTGGGAAGGGCAGGGCATGG + Intergenic
1107086546 13:36432366-36432388 GGGCAGGGAAGGGCAGGGCACGG - Exonic
1107684879 13:42886832-42886854 GTGCAGGGTAGGCCAGGCAGTGG + Exonic
1108922412 13:55692700-55692722 GGGTAGGGAAGGCATGGCAATGG - Intergenic
1109089004 13:58015202-58015224 TTTCAGGGAAGGCCTAACCAAGG + Intergenic
1109182175 13:59226697-59226719 ATACAGGGAAAGCCTAGCCAAGG + Intergenic
1109784445 13:67156037-67156059 GTGCTGGGAAGGCAAGACCATGG + Intronic
1112398651 13:99056797-99056819 CTCCAGGGAAGGCCTGTCCTGGG - Intronic
1113662200 13:112115175-112115197 GTGAGTGGAAGGGCTGGCCATGG + Intergenic
1113800731 13:113085195-113085217 GTGCTGGGGAGGCCGGGCCACGG - Intronic
1113940747 13:114017508-114017530 GTGCTTGGAGGCCCTGGCCATGG + Intronic
1114196813 14:20485336-20485358 GTTCAGGGAAGGCCTCTCCAAGG + Intergenic
1114261084 14:21036797-21036819 CTGCTGGGAAGACCTCGCCAAGG + Intronic
1115990979 14:39149606-39149628 GTGCATGGAAGTCCTGGTAAAGG - Exonic
1117253492 14:53956352-53956374 GGACAGAGAAGGCCTGGGCAGGG + Intronic
1117664980 14:58047096-58047118 CTGCAAGGAAGGCCTAGCTATGG - Intronic
1117815797 14:59596382-59596404 CGGCAGGAAAGGCCTAGCCACGG + Exonic
1117980624 14:61339255-61339277 CAGAAGGGAAGGCCTGGCCCAGG - Intronic
1118317159 14:64732368-64732390 GGGCAGGGAAGGCCGGCACATGG + Intronic
1118771110 14:68943359-68943381 GTGCAGGGCAGGACGGGACAAGG + Intronic
1119328638 14:73777490-73777512 GGGCAGGCAGGGCCGGGCCATGG - Intronic
1119543826 14:75457620-75457642 GTGCAGGAAAGGCCTGGGGCTGG + Intronic
1119643426 14:76330853-76330875 ATGCAGGGTGGGGCTGGCCACGG + Intronic
1120880776 14:89413878-89413900 GGGCAGGGAAGGGCAGGGCAGGG + Intronic
1121527217 14:94627522-94627544 ATGCAGGCAGGGCCTGGCGAGGG + Intergenic
1121537924 14:94703930-94703952 GGTCAGGGAAGGCCTCTCCAAGG + Intergenic
1121679041 14:95777342-95777364 GTGCAAGGTAGGCCTGGGCTGGG - Intergenic
1122011324 14:98751370-98751392 GTGCAGAAAAGGCCTGGAGAAGG + Intergenic
1122113592 14:99517165-99517187 GTGCGGGGCAGGCCGGGCCCTGG + Exonic
1122145145 14:99684388-99684410 GGGCAGGGCAGGCCAGGCCAGGG - Exonic
1122153446 14:99736946-99736968 GTGCAGGGCAGGACCAGCCAAGG - Intergenic
1122296601 14:100709433-100709455 CAGCAAGGAAGGCCAGGCCAGGG - Intergenic
1122632024 14:103111566-103111588 GAGCAGGGCAGGCCAGGGCAAGG + Intergenic
1122679440 14:103446617-103446639 TTGCAGGGATGCCATGGCCATGG + Intronic
1122859050 14:104574073-104574095 GTGCAGGGGAGTCATGACCAAGG + Intronic
1126361056 15:47846482-47846504 GTGCATAGAATGCCTGGACATGG - Intergenic
1127560050 15:60127295-60127317 GGGCTGGGCTGGCCTGGCCAGGG - Intergenic
1128237457 15:66077924-66077946 GGGCCAGGAAGGCCGGGCCAAGG + Intronic
1128329653 15:66747282-66747304 GTGGTGGGAAGGCCAGGCCTTGG - Intronic
1128684693 15:69674998-69675020 GTGCTGGGCAGGCATGGGCATGG + Intergenic
1129159148 15:73737532-73737554 GAGCTGGGAAGAGCTGGCCATGG + Exonic
1129332884 15:74836807-74836829 GTCCCGGGAAGGGCAGGCCAGGG + Exonic
1132300254 15:100770966-100770988 GGGAGGGGAAGGCCTGGCCAAGG - Intergenic
1132587983 16:714609-714631 AGGCGGGGAAGGCCTGGCCTGGG - Intronic
1132810459 16:1794385-1794407 GTGTGGGGGTGGCCTGGCCATGG + Intronic
1132884627 16:2177217-2177239 GGGCAGGGGAGGTCTGGGCAAGG - Exonic
1133212606 16:4271848-4271870 GTGCAGGGAAAGCGTGGCCCAGG + Intronic
1133770267 16:8863653-8863675 GGCCAGAGTAGGCCTGGCCAAGG + Intronic
1134193060 16:12137330-12137352 CTGCAGGGGAGGCTTGGACAAGG - Intronic
1134877392 16:17713547-17713569 GTTCAGGTGAGGCCTGACCAAGG - Intergenic
1135323489 16:21512052-21512074 GGCCAGGCAAGGCCTGCCCATGG + Intergenic
1136069548 16:27779512-27779534 GTGCAGGGAGGGCCTGCTCAAGG - Exonic
1136516552 16:30772063-30772085 GGGCAGGAGAGGCCTGGCTAAGG - Intronic
1136591100 16:31218215-31218237 GATCAGGGAAGGCAAGGCCAGGG + Intronic
1136656384 16:31711712-31711734 GTGCAGAGAGGGAGTGGCCATGG - Intergenic
1136998544 16:35208112-35208134 CTGCATGGAAGGGCTGGGCAGGG + Intergenic
1137626630 16:49912907-49912929 GCACAGGGCTGGCCTGGCCAGGG - Intergenic
1138088362 16:54154439-54154461 GTTCTGGGGAGGCCCGGCCAGGG - Intergenic
1138122124 16:54408918-54408940 GTTCAAAGAAGACCTGGCCATGG + Intergenic
1138371566 16:56531001-56531023 TTGCAGGGGAAGCCAGGCCAGGG - Intergenic
1138458879 16:57136294-57136316 CTGCCCAGAAGGCCTGGCCAGGG - Intronic
1138830496 16:60368851-60368873 GTTCAGGGAAGGCATCTCCAAGG + Intergenic
1139307732 16:66001676-66001698 TTGCAGTGAAGGACTGGTCATGG + Intergenic
1139529328 16:67535257-67535279 GGGCAGTGAGGGCCTGGCCAAGG + Intronic
1142035690 16:87861136-87861158 GGCCAGGCAAGGCCTGCCCATGG + Intronic
1142363334 16:89637414-89637436 GAGCTGGGAGGGCCTGCCCAGGG - Intronic
1142377143 16:89711996-89712018 CTGCGGGGAGGGCCTGGCCCCGG - Intronic
1143204382 17:5132175-5132197 GTGCAGGGACAGCCTGGCTGGGG - Intronic
1144859067 17:18288679-18288701 GTGCAGGGTAGGCCTGAGGAAGG - Intronic
1144875454 17:18394866-18394888 GTGCAGGGACAGCCTGGCTGGGG - Intergenic
1144949396 17:18985787-18985809 GAGCAGGGCAGGCGGGGCCAGGG + Intronic
1145156771 17:20549555-20549577 GTGCAGGGACAGCCTGGCTGGGG + Intergenic
1145760109 17:27420883-27420905 GTGCAGGGCCAGCCTGGCCGAGG - Intergenic
1145762193 17:27431488-27431510 GTGCTGGGAAGGGCTGGGCATGG - Intergenic
1146661811 17:34669856-34669878 CAGCAGGGAAGACCTGGTCAAGG - Intergenic
1146842517 17:36165800-36165822 GTGCTGGGAGGGGCTGGGCATGG + Exonic
1146844282 17:36173646-36173668 GTGTAGGGACAGCCTGGCCGGGG + Intronic
1146854829 17:36253759-36253781 GTGCTGGGAGGGGCTGGGCATGG + Intronic
1146856587 17:36261581-36261603 GTGTAGGGACAGCCTGGCCGGGG + Intronic
1146864030 17:36326794-36326816 GTGTAGGGACAGCCTGGCCGGGG - Intronic
1146865791 17:36334617-36334639 GTGCTGGGAGGGGCTGGGCATGG - Exonic
1146870729 17:36377651-36377673 GTGCTGGGAGGGGCTGGGCATGG + Exonic
1146872497 17:36385492-36385514 GTGTAGGGACAGCCTGGCCGGGG + Intronic
1146878087 17:36428732-36428754 GTGCTGGGAGGGGCTGGGCATGG + Exonic
1146879855 17:36436577-36436599 GTGTAGGGACAGCCTGGCCGGGG + Intronic
1146927642 17:36755906-36755928 GGTCAGGGAAGGCCTGGCTGGGG - Intergenic
1147000636 17:37359458-37359480 GGGCCGCGAAGGCCGGGCCAGGG - Intronic
1147054573 17:37824539-37824561 CTGCAGGGATGGCCAGGGCAGGG - Intergenic
1147066890 17:37927382-37927404 GTGTAGGGACAGCCTGGCCGGGG - Intronic
1147068661 17:37935229-37935251 GTGCTGGGAGGGGCTGGGCATGG - Exonic
1147073612 17:37978275-37978297 GTGCTGGGAGGGGCTGGGCATGG + Intergenic
1147075381 17:37986116-37986138 GTGTAGGGACAGCCTGGCCGGGG + Intronic
1147078422 17:38006943-38006965 GTGTAGGGACAGCCTGGCCGGGG - Intronic
1147085134 17:38057813-38057835 GTGCTGGGAGGGGCTGGGCATGG + Exonic
1147086906 17:38065662-38065684 GTGTAGGGACAGCCTGGCCGGGG + Intronic
1147094360 17:38130878-38130900 GTGTAGGGACAGCCTGGCCGGGG - Intergenic
1147096132 17:38138726-38138748 GTGCTGGGAGGGGCTGGGCATGG - Intergenic
1147101080 17:38181779-38181801 GTGCTGGGAGGGGCTGGGCATGG + Intergenic
1147102851 17:38189625-38189647 GTGTAGGGACAGCCTGGCCGGGG + Intergenic
1147353514 17:39870331-39870353 GTTCAGAAAAGGCCTGGGCACGG - Intronic
1148588400 17:48797315-48797337 GTGGAGGGCAGGCTTGTCCAGGG + Intronic
1148911293 17:50944463-50944485 GGGCAGGGAAGCCCTGGACCTGG + Intergenic
1149546630 17:57508729-57508751 GAGCCCGGCAGGCCTGGCCAAGG + Intronic
1149847425 17:60016092-60016114 GTGTAGGGACAGCCTGGCCGGGG + Intergenic
1150085783 17:62272709-62272731 GTGTAGGGACAGCCTGGCCGGGG + Intronic
1150480308 17:65503993-65504015 ATGCAGGGAAAGCCTGGGGATGG + Intergenic
1151419006 17:73985376-73985398 CAGCAGGCCAGGCCTGGCCATGG + Intergenic
1151459741 17:74247493-74247515 GTGAAGAGCAGGCCTGGCCTGGG + Intronic
1151576687 17:74955989-74956011 GTGCAGGGATGGCTTGGCTGAGG - Intronic
1151675374 17:75594834-75594856 CTACAGGGACGCCCTGGCCAAGG + Intergenic
1152101063 17:78301985-78302007 GTGCAGGGCAGGCCAGGCCTGGG - Intergenic
1152128572 17:78462191-78462213 GTGCCGAGCAGGGCTGGCCAGGG + Intronic
1152450269 17:80374235-80374257 GTGCAGGGAATGCCTGCCGACGG - Intronic
1152637530 17:81436227-81436249 GAGCAGGGCAGCACTGGCCAGGG - Intronic
1152686300 17:81695353-81695375 GGGCAGGGCAGGGCAGGCCAGGG - Intronic
1152701336 17:81821420-81821442 GTGTAGCAATGGCCTGGCCAGGG + Intergenic
1152877191 17:82793611-82793633 CTCCAGGAAAGGCCTGGCCCTGG + Intronic
1153713180 18:7820272-7820294 CTGCAAGGAGGGCCTGGCCGGGG + Intronic
1154357663 18:13633917-13633939 CAGCAGGGGAGGCATGGCCAGGG - Intronic
1155640030 18:28002218-28002240 GTGCAAGGCATGCCTGGCCAAGG + Intronic
1156483097 18:37448433-37448455 GTGAAGGCAAGGCCTCGCCAGGG - Intronic
1157246051 18:46056258-46056280 GGGCAGGGAAAGCCTGGAGAGGG - Intronic
1158321735 18:56270770-56270792 GGGAAGGGAAGGCAAGGCCAGGG + Intergenic
1159480215 18:68980689-68980711 GTGGAGGGAAGGGCTACCCAAGG + Intronic
1159527818 18:69616350-69616372 GTGATGGGAAGGCCAGGCCTGGG - Intronic
1159774406 18:72586166-72586188 CAGCAGGGGAGGCATGGCCAGGG - Intronic
1160095058 18:75863670-75863692 GTGCAGGGTCAGCCTCGCCATGG + Intergenic
1160542105 18:79629428-79629450 GTGCAGGGAAGCCCCAGGCAGGG + Intergenic
1160854665 19:1211356-1211378 GAGCAGGGAAGGGCTGGAAAGGG + Intronic
1160868210 19:1265497-1265519 CTGCTGGGATGGCCTGGCCGGGG + Intronic
1161260742 19:3336656-3336678 GTGCAGGGCAGGCCTGGGAGTGG + Intergenic
1161303971 19:3556952-3556974 GTGCAGGGAAGCTCGGGCCACGG + Intronic
1161615018 19:5265264-5265286 GCTCAGGGACTGCCTGGCCACGG + Intronic
1162110023 19:8395013-8395035 GTGTCGGGAATGCCTGGGCAGGG + Intronic
1162567870 19:11454111-11454133 GTGCTGGGGAGGCCTGGGCAAGG + Exonic
1163006715 19:14401570-14401592 GGGCAGGGCAGGCCAGGCCAAGG - Intronic
1163145166 19:15374725-15374747 GCGGAGGGAAGCCCTGGCCCTGG - Intronic
1163695427 19:18761173-18761195 GGGCCGGGACGGCCTTGCCAAGG - Intronic
1163722485 19:18904895-18904917 AGGCAGGGATGGCCAGGCCAGGG - Intronic
1164433277 19:28207020-28207042 GAGAAGGAAAGGCCTGGCCTAGG + Intergenic
1164578731 19:29421264-29421286 GTGCAGACACGGCCTGGGCAGGG + Intergenic
1164775698 19:30851940-30851962 ATGCAGGGAAGGCCTTCCTAGGG + Intergenic
1164871382 19:31647015-31647037 GTGGAGGTAAGGCATGGCCTTGG - Intergenic
1165120961 19:33558223-33558245 CTGCAGGGAAGGCTTAGCAAAGG - Intergenic
1165140920 19:33699357-33699379 GTGGAGGGGAGACCTGGCCCTGG + Intronic
1165145707 19:33728724-33728746 GTGCAGGGGAGCCCAGGCCAGGG + Intronic
1165832458 19:38736409-38736431 GGGCAGGGGAGGCGTGGACAGGG - Intronic
1165838145 19:38771695-38771717 GGGTAGGGAAGTCGTGGCCAAGG - Intronic
1165841420 19:38791002-38791024 GGGTAGGGAAGTCGTGGCCAAGG + Intronic
1166309835 19:41956779-41956801 GTGCAGGACAGGCATGGGCAGGG + Exonic
1166734331 19:45075571-45075593 GTGCAGCCTAGGCGTGGCCAGGG - Intronic
1166794232 19:45416732-45416754 GAGAAGGGAAGGGCTGGGCAGGG + Intronic
1166861342 19:45813321-45813343 GGTCAGTGAAGGCCTGTCCAAGG - Intronic
1167232059 19:48291071-48291093 GTGCAGGGAGGCTCTGGCCTGGG - Intergenic
1167660364 19:50792559-50792581 GTACAGTGAGGGCCTTGCCAGGG + Intronic
925576200 2:5362870-5362892 GTCCAGGGAAGCTCTGGCAAGGG - Intergenic
926316622 2:11714956-11714978 CTGCAAGGAAGGCCTGGCCTGGG + Intronic
927186054 2:20483494-20483516 ATACAGGGAAGGACTGGCCTGGG - Intergenic
927917665 2:26947287-26947309 GTGAGAGGAAGGGCTGGCCAGGG - Exonic
927948195 2:27149925-27149947 GTTGGGGGAAGGCCTGGCCAGGG - Intronic
929833307 2:45368953-45368975 GTGCAGTGAAGGTCAGACCAGGG + Intergenic
930025524 2:47027042-47027064 GGGCCAGGAAGGCCTGGCCCTGG - Intronic
930242962 2:48955241-48955263 ATGCAGGGAGGGCCTAGGCAGGG + Intergenic
932780747 2:74556943-74556965 GTTCAGGGAAGGCTGGGCCCTGG - Exonic
933786908 2:85850496-85850518 CTGCTGGGCAGGCCTGGCCAGGG - Intronic
934475651 2:94591681-94591703 GTGCAGGAATGGGCTGGCCACGG - Intronic
935140346 2:100347926-100347948 GTACAGGGCAAGGCTGGCCATGG + Intergenic
936072512 2:109380754-109380776 GGGCAGGGATTGCCTGGCTAAGG - Intronic
937086187 2:119173564-119173586 GTGGGGGCAGGGCCTGGCCAAGG - Intergenic
937100561 2:119264919-119264941 ATGCAGGGAAGGCCATGCCGGGG + Exonic
937220946 2:120343153-120343175 GGTCAGGGAAGGCTTCGCCAAGG + Intergenic
937293064 2:120793622-120793644 GTGGTGGGAAGGCGAGGCCACGG + Intronic
937295127 2:120805430-120805452 GTGCCGGCCAGGCATGGCCAAGG - Intronic
937338839 2:121078028-121078050 GTGCGGGGAAGGCCTCGGAAGGG + Intergenic
938339583 2:130526729-130526751 GGGCAGGGCAGGCCTGGTCAGGG + Intronic
938350253 2:130594021-130594043 GGGCAGGGCAGGCCTGGTCAGGG - Intronic
938954348 2:136284255-136284277 GTGCTGGGAAGGGCAGGCCCAGG - Intergenic
938983140 2:136545847-136545869 GTGCAGGGAAGGCTTTTCAAAGG - Intergenic
940693948 2:156955925-156955947 CTGAAGGGCAGGCCTGGACAGGG + Intergenic
941005345 2:160241714-160241736 CTTCAGGAAAGGCCTGGCCTTGG - Intronic
944701343 2:202249011-202249033 GTGAAGGGAAGGCCCACCCATGG - Intergenic
946161825 2:217840208-217840230 GTGTAGGGCAGGCCTGAGCATGG + Intronic
947620949 2:231590737-231590759 GTGAAGGGAAGGCCTGATCCTGG + Intergenic
948069833 2:235111704-235111726 GTGCAAGGATTCCCTGGCCATGG - Intergenic
948372506 2:237498548-237498570 GGGAGGGGCAGGCCTGGCCAAGG - Intronic
948454601 2:238098968-238098990 GAGCAGAGCAGGCCTGGCCGAGG - Exonic
948556296 2:238813725-238813747 GGGAGAGGAAGGCCTGGCCAAGG - Intergenic
948691400 2:239707123-239707145 GGGCAGGGAAGGGCAGGGCAAGG - Intergenic
948691478 2:239707353-239707375 GGGCAGGGAAGGGCAGGGCAAGG - Intergenic
948947621 2:241229070-241229092 GTGCAAGGAAGACCTGGCAATGG - Exonic
948988957 2:241542128-241542150 GTGCAGGGCAGGACAGGTCAGGG - Intergenic
949026542 2:241768997-241769019 GCACAGGGCAGGCCTGGACATGG + Intergenic
1168908388 20:1425279-1425301 ATGCTGAGCAGGCCTGGCCAGGG - Intergenic
1169210675 20:3764751-3764773 TTGCTTGGAGGGCCTGGCCAAGG + Intronic
1169213135 20:3778608-3778630 GAGAAGGGAAGGCCTGGTCGAGG - Intronic
1170163894 20:13343260-13343282 GTGCTGGGTAGGCCTGGCTGAGG - Intergenic
1171291610 20:23985819-23985841 GTGCAGGGTGGGCACGGCCAGGG + Intronic
1171454021 20:25256724-25256746 GAGCAGGGAAGCCCTGTTCATGG + Intronic
1172396165 20:34607310-34607332 ATGCGGGGCAGGCCAGGCCAGGG - Intronic
1173017000 20:39234773-39234795 GGTCATGGGAGGCCTGGCCAGGG + Intergenic
1173538473 20:43833460-43833482 GTGCACAGAAGGCCAGGCCCAGG + Intergenic
1173867400 20:46321356-46321378 AAGCAGGAAAGGGCTGGCCAGGG - Intergenic
1174038597 20:47683344-47683366 GTGGAGGGGAGGGCGGGCCAGGG - Intronic
1174436641 20:50511341-50511363 GATCAGGGAAGGCCTGTCAAAGG + Intronic
1174444442 20:50581091-50581113 TTGGAGGGAGGGCCAGGCCAGGG - Intronic
1174648375 20:52104704-52104726 GTCCAGGGAAGGCCTCACCGAGG - Intronic
1175074426 20:56360853-56360875 GTGCAGGGAGGGTCTGGGCTTGG + Intronic
1175410978 20:58768944-58768966 GGGCAGGGCAGCCATGGCCAGGG - Intergenic
1175756779 20:61535304-61535326 GTGCAGAGGTGCCCTGGCCAAGG + Intronic
1175989189 20:62779060-62779082 GTGCCGAGAAGGTGTGGCCAGGG - Intergenic
1176095758 20:63343672-63343694 GGGCTGGGAAGCCCTGGCCAGGG + Intronic
1177344768 21:19854464-19854486 CAGCAGGGAAGGCGTGGCCGGGG - Intergenic
1177837784 21:26204724-26204746 ATGGAGGGATGGCCTGGCCGAGG - Intergenic
1178947245 21:36958963-36958985 GAGCAGGGTAGGCGCGGCCAGGG + Intronic
1179229597 21:39489438-39489460 TTGCAGGAAGGGCCTGGGCATGG + Intronic
1179576704 21:42312648-42312670 GTGAAGGGAGGCCCTGGGCAGGG + Intronic
1179645822 21:42775353-42775375 GTGCAGGGAAGAGCTGCCCTGGG + Exonic
1179805242 21:43833106-43833128 GTGCAGGGAAGGGCTGTCTGGGG - Intergenic
1180195370 21:46190668-46190690 GTGCAGGAGAAGCCTGCCCAGGG + Exonic
1180231306 21:46428327-46428349 CAGCAGGGAAGGCCGGGGCATGG + Intronic
1180945130 22:19688519-19688541 GGGCAGGCACGGCCGGGCCACGG - Intergenic
1181022295 22:20109855-20109877 GAGCAGGGAAGGCCTGGGGCAGG - Intronic
1181286053 22:21753463-21753485 CGGCAGTGGAGGCCTGGCCAGGG + Intergenic
1181306381 22:21919609-21919631 GTGCAGTGCAGGCCTTGCGAAGG - Exonic
1181400338 22:22647116-22647138 GTGCAGGGTGGGCACGGCCAGGG - Intronic
1181649027 22:24248675-24248697 GTGCAGGGTGGGCACGGCCAGGG + Intergenic
1181702317 22:24628214-24628236 GTGCAGGGTGGGCACGGCCAGGG - Intronic
1181730875 22:24845470-24845492 GTACAGCAAAAGCCTGGCCATGG - Intronic
1182059412 22:27386282-27386304 GAGCTGGGAAGCCTTGGCCAGGG - Intergenic
1182747537 22:32617016-32617038 CGGGAGGGAAGGGCTGGCCAAGG + Intronic
1183153201 22:36053854-36053876 GGGCAGGGAAGGGCAGGTCAAGG - Intergenic
1183282171 22:36937768-36937790 GTGGAGAGAAGGCCGAGCCAGGG + Exonic
1183590267 22:38775813-38775835 GTGCAGGGGAGGCCTGGCGATGG + Intronic
1184479056 22:44736648-44736670 CTGCAGGGAAGGCCCGACCCGGG - Intronic
1184635132 22:45821981-45822003 GAGCAGGGAAGGCCTGGTGCTGG - Intronic
1184650845 22:45918901-45918923 CTGCAGGGCAGGGGTGGCCAGGG + Intergenic
1184989089 22:48155155-48155177 GGGGAGGGCAGGCCAGGCCAGGG + Intergenic
1185053876 22:48567880-48567902 GTGCTGGGCAGGCCTGGGAACGG + Intronic
949494830 3:4621648-4621670 GTGCAGGGCAGTGCAGGCCATGG - Intronic
950026790 3:9825674-9825696 CTGCAGGGAGGGCGTGACCAAGG + Intronic
950109022 3:10406824-10406846 GAGAAGGTAAGGCCTGGGCAGGG + Intronic
950535199 3:13574518-13574540 AGGCAGGGATGGCCTGGCCGAGG + Intronic
950548106 3:13650744-13650766 GTGCAGGCCAGGCCCGGCCGGGG + Intergenic
950550970 3:13665720-13665742 GTGCTGGGCAGGGCTGCCCAGGG + Intergenic
950648392 3:14392238-14392260 ATGCAGGAAAGGGCTGGTCATGG - Intergenic
952411266 3:33052051-33052073 TTGCAGGGAAGCCCTGGCATTGG - Intronic
952827473 3:37536319-37536341 GTGCCTGGAAGGCCTGCCCAGGG - Intronic
953199927 3:40769452-40769474 TTGCAGGGAAAGACTGGGCAGGG + Intergenic
954155072 3:48680905-48680927 CTGCAGGGAAGGAATGGACACGG - Intronic
954456281 3:50601405-50601427 GGGCAGAGAAGGCCTGGCGTGGG - Intergenic
954693773 3:52409904-52409926 GGGGAGGGAGGGCCTGGACATGG - Exonic
955030611 3:55213239-55213261 GTGTTGGGAAGTTCTGGCCAGGG + Intergenic
955127395 3:56126893-56126915 GGGCAGGGAAGGGCAGGGCAGGG + Intronic
955211861 3:56949259-56949281 GTGTTGGGAAGTTCTGGCCAGGG + Intronic
955246189 3:57227545-57227567 GTGCAGGGAAGGCCATCCCAGGG + Intergenic
960348710 3:116567187-116567209 GGGCAGGGATGGCAAGGCCAAGG + Intronic
960571860 3:119192299-119192321 GGGTAGGGAAGGACTGGCTATGG - Intronic
960639184 3:119810420-119810442 GTGCTGGGCAGCCCTGGACAGGG + Intronic
961448204 3:126990973-126990995 GAGCAGGGGAGGCTGGGCCAGGG - Intronic
961459108 3:127039080-127039102 GGGCAGGGAAGGCCTGAGGAGGG + Intergenic
964149186 3:153503491-153503513 GTACAAGAAAGGCTTGGCCAAGG + Intergenic
966058511 3:175727165-175727187 GTGCAGGGAAGGCATGCTCCAGG + Intronic
966090470 3:176129445-176129467 GTGCATGGATGGGCTGGGCATGG - Intergenic
967235120 3:187376699-187376721 GTGCATGAAAGGAGTGGCCATGG - Intergenic
968044465 3:195616296-195616318 GTGCAGCGCAGACCAGGCCACGG - Intergenic
968060254 3:195722347-195722369 GTGCAGCGCAGACCAGGCCACGG - Intronic
968502041 4:955340-955362 GTGTGGGTAAGGCCTGGCCTCGG + Intronic
968626793 4:1629449-1629471 GTGCCCTGGAGGCCTGGCCAGGG + Intronic
968652369 4:1765323-1765345 GTGCAGGGAGGGGCCTGCCAGGG + Intergenic
968658381 4:1788403-1788425 GGGCAGTGGAGGGCTGGCCAGGG - Intergenic
968725384 4:2245555-2245577 GTACAGGGCTGACCTGGCCAAGG + Intergenic
968885008 4:3324201-3324223 GTCAAGGGAAGGCCTGACGAGGG - Intronic
969443146 4:7228954-7228976 GGGACGGGACGGCCTGGCCACGG - Intronic
969519278 4:7666423-7666445 GGGCAGGGGAGGCCTGGGCTGGG - Intronic
969677346 4:8621393-8621415 GTGCAGGGAAGGCCTCGTGCAGG - Intergenic
969678301 4:8627031-8627053 GTGCAGGGAAGGCCTCGTGCAGG - Intergenic
969679257 4:8632669-8632691 GTGCAGGGAAGGCCTCGTGCAGG - Intergenic
970606638 4:17687715-17687737 TTGCAAGGAAGACTTGGCCAAGG + Intronic
971339813 4:25757727-25757749 GTGCAGGTAAAGCCAGGCCAAGG + Exonic
971358169 4:25913504-25913526 GTGCTGGGATGCCTTGGCCAAGG - Intronic
971376836 4:26062531-26062553 GTGCAGTGAAGGCTGAGCCAAGG - Intergenic
974832399 4:67205923-67205945 GGGCAGGTAAAGTCTGGCCAGGG - Intergenic
975323369 4:73033635-73033657 GTGAATGTAAGTCCTGGCCATGG + Intergenic
975909116 4:79247711-79247733 GTGCATGGTAGTCCTGGGCAGGG - Intronic
976601382 4:86940795-86940817 GTGAAGGGAGGGGCTGGGCATGG + Intronic
978230592 4:106392799-106392821 GTGCAGGGCAGGAATGGCAAGGG - Intergenic
978663550 4:111155166-111155188 CAGCAGGGGAGGCCTGGCCAGGG - Intergenic
979492048 4:121339506-121339528 GTGCTGGGGATGCCTGGCAAAGG - Intronic
980988245 4:139716246-139716268 GTGCAGGTGAAGCCAGGCCATGG + Intronic
984367972 4:178822543-178822565 GTGCAGGGATGGCGTAGACAAGG + Intergenic
985537074 5:471523-471545 GTGCCGGGAAGGCCAGGCCCCGG + Exonic
985711425 5:1431770-1431792 GTGCAGGTCAGGCCTGGCCAGGG + Intronic
985756809 5:1724317-1724339 GTGCAGGGTGGGCATGGCCGAGG - Intergenic
985756824 5:1724364-1724386 GTGCAGGGTGGGCATGGCCGAGG - Intergenic
985756839 5:1724411-1724433 GTGCAGGGTGGGCATGGCCGAGG - Intergenic
985756866 5:1724505-1724527 GTGCAGGGTCGGCATGGCCGAGG - Intergenic
985805324 5:2039002-2039024 GGGCAGGGCAGGGCTGGGCAGGG + Intergenic
985874283 5:2583559-2583581 GTGCAGAGGAGGCCAGACCAGGG - Intergenic
986341299 5:6791468-6791490 GTGATGGGAAAGCGTGGCCAGGG - Intergenic
986670800 5:10140850-10140872 GTGCAGGGAAGGCCTGGAAGGGG + Intergenic
990207971 5:53450696-53450718 CTGGAGGGAAGGGCTGGCCTGGG - Intergenic
992645424 5:78807242-78807264 GTGGAGGGCAGGCTTGGCCCTGG - Intronic
994696605 5:103079755-103079777 CTGCAGGCAAGTCCTGCCCAAGG + Intergenic
995086236 5:108113154-108113176 TTGCAGGGAAGGTATGGGCAGGG + Intronic
997053263 5:130408421-130408443 GTGATAGGAAGTCCTGGCCAGGG - Intergenic
997261217 5:132466731-132466753 GTCCTGGGCAGGCCTGGACAGGG - Intronic
997479778 5:134176580-134176602 GTGCAGAGAAGGCCCAGCCCGGG + Intronic
998093556 5:139384374-139384396 CTTCAGGCAGGGCCTGGCCATGG - Intronic
999154625 5:149449731-149449753 GGTCAGGGAAGGGCTGGCCGGGG - Intergenic
999219005 5:149959863-149959885 GGTCAGGGACGGCCTCGCCATGG + Intergenic
1001040788 5:168333694-168333716 GTGCAGGTAAAGCCTGGGCGGGG - Intronic
1001313842 5:170629288-170629310 ATGCAGGGACCTCCTGGCCAAGG + Intronic
1001403018 5:171457331-171457353 GCGCAGGGAAGGCGTGCCCCTGG + Exonic
1001997685 5:176175119-176175141 GTGCAGGGGCGGCATGACCAGGG - Intergenic
1002101981 5:176862266-176862288 GTCCAGGGCAAGGCTGGCCAAGG - Intronic
1002280037 5:178124531-178124553 CTGCAGGGAAGGCTAAGCCAGGG - Exonic
1002921311 6:1575289-1575311 CTACAGAGGAGGCCTGGCCAGGG - Intergenic
1002960472 6:1909714-1909736 ATGCAGGGACGGCATGGCTATGG + Intronic
1003016941 6:2475572-2475594 GGGCACAGAGGGCCTGGCCAAGG - Intergenic
1003479271 6:6516408-6516430 GCACAGGGCAGGCCTGGACAGGG - Intergenic
1005198996 6:23322027-23322049 GGGCAGGGAAGTCATGGCAAGGG - Intergenic
1006295266 6:33167395-33167417 CTGCAGGGAAGGGCTGGGCTGGG - Intronic
1006390646 6:33756277-33756299 GGTCAGGGAAGGCCTGGCGGAGG + Intergenic
1006523106 6:34583493-34583515 TTGCAGGGGAGGCCAGGCCAGGG + Intergenic
1007204657 6:40138889-40138911 GTGCAGGGAGAACCTGGCCTCGG - Intergenic
1007292412 6:40797520-40797542 GTCCAGGGAAGGCCTGTCTGAGG - Intergenic
1007496013 6:42260760-42260782 GTGATGGGAAGGGCTGGCTACGG + Intronic
1007793299 6:44326527-44326549 GTGGAGGCGGGGCCTGGCCAGGG + Intronic
1008283957 6:49626988-49627010 GAGCAGGGAAGCCCTGGGCCTGG + Intronic
1009241824 6:61194005-61194027 CAGCAGGGGAGGCATGGCCAGGG - Intergenic
1010029932 6:71263000-71263022 GGGCAGGGAAGACCTGGCGGCGG + Intergenic
1011933020 6:92737814-92737836 GAGCAGGGATGACCTGGCCCTGG - Intergenic
1013117700 6:107115182-107115204 GCGCGCGGAGGGCCTGGCCAGGG + Intronic
1013368065 6:109449586-109449608 GGGCAGGGAGGGCCTGACCTGGG + Intronic
1013484855 6:110587114-110587136 GTGCATGGGAGCCCTGGCTAAGG + Intergenic
1015792954 6:136982323-136982345 GGGAAGGGAAGGCCAAGCCAGGG + Intergenic
1015855691 6:137622123-137622145 GAGCAGGGCAGGCATGGCGAAGG - Intergenic
1016163447 6:140908779-140908801 CAGCAGGGAAGGGGTGGCCAGGG - Intergenic
1017047907 6:150364576-150364598 GTGAAAGAGAGGCCTGGCCATGG + Intergenic
1017054471 6:150424878-150424900 GTGAAGGTAAGGCCTCACCAGGG - Intergenic
1017646124 6:156541297-156541319 GGGCAGGGAGGCCCTGGCAAAGG + Intergenic
1018220116 6:161569645-161569667 GGGGAGAGAAAGCCTGGCCAGGG - Intronic
1018608086 6:165620285-165620307 GTGCAGATACTGCCTGGCCAGGG - Intronic
1018676603 6:166227613-166227635 GTGCAGGGATGGCCTCCCAATGG - Intergenic
1018866271 6:167748845-167748867 GAGCAGAGCTGGCCTGGCCAGGG + Intergenic
1019326359 7:440264-440286 GTGCAGGGAGGGCTTGGTCTTGG - Intergenic
1019379079 7:712112-712134 GTGCCGGCCTGGCCTGGCCATGG - Intronic
1019713588 7:2528503-2528525 GTGAAGGGGAGGCTTGGCCTTGG + Intronic
1019743803 7:2688528-2688550 GCAGAGGGAAGGCCGGGCCAGGG + Intronic
1020003437 7:4768621-4768643 GTGCATGGCAGGCCTAGCCCTGG - Exonic
1020083164 7:5297126-5297148 GGGCAGGCCAGGCCTGGGCAGGG + Exonic
1021928493 7:25556080-25556102 TTGGAGGGTAGGCCTGGCTAGGG - Intergenic
1022090701 7:27106358-27106380 GTCCAGGGAAGGGCTGGCTCAGG + Exonic
1022497877 7:30864643-30864665 GTGCAGCCCAGGCCTGGCCACGG - Intronic
1022511356 7:30936853-30936875 CTGCAGGGAGTGACTGGCCAGGG + Intergenic
1023064795 7:36366889-36366911 GTGCCGGGAAGGGCTGGCCGCGG - Intronic
1024016368 7:45319397-45319419 GTGTTGGGAAGTTCTGGCCAGGG + Intergenic
1024097874 7:45999399-45999421 GTCCAGGGATGTCATGGCCAAGG + Intergenic
1024117207 7:46205734-46205756 TTGCAGGGAAGGCCTGCCCTTGG - Intergenic
1024944676 7:54796771-54796793 GTCTAGGGAAGGCAGGGCCAAGG + Intergenic
1025211119 7:57020061-57020083 GGGCAGGCCAGGCCTGGGCAGGG - Intergenic
1025660836 7:63556786-63556808 GGGCAGGCCAGGCCTGGGCAGGG + Intergenic
1026217815 7:68365126-68365148 GTGCCTGGCAGGCATGGCCATGG + Intergenic
1026734547 7:72941388-72941410 GTGCCGTGAAGGCCTGGGCCGGG - Intronic
1026784881 7:73296296-73296318 GTGCCGTGAAGGCCTGGGCCGGG - Intergenic
1026950014 7:74340755-74340777 GTACAGGGAAGGCCCTGACATGG + Intronic
1027109196 7:75423634-75423656 GTGCCGTGAAGGCCTGGGCCGGG + Intronic
1027742771 7:82033065-82033087 GTGAGGGGAAGGCCTGGTGAAGG - Intronic
1028892314 7:96002099-96002121 CTGCTGTGAGGGCCTGGCCATGG - Intronic
1028896504 7:96047693-96047715 TAGCAGGGAAAGCCAGGCCAAGG + Intronic
1029123900 7:98284726-98284748 CTTCAGCGAAGGCCTGGCCAGGG - Intronic
1029690757 7:102179798-102179820 GAGCAGGGAACCCCTGGCCTGGG - Intronic
1030117135 7:106070538-106070560 GGGCAGGCAAGCCCTGACCAGGG + Intergenic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1032551307 7:132786992-132787014 GAGCAGGGAAGGCTTCTCCAAGG + Intronic
1033362336 7:140646675-140646697 ATGTAGGGGAGGCTTGGCCAAGG - Intronic
1033543698 7:142380870-142380892 GGGCAGGTAAGTCCTGGGCAGGG + Intergenic
1033857207 7:145578060-145578082 ATGCAGGGCAGGGCAGGCCAGGG + Intergenic
1033870569 7:145749951-145749973 GTGCAGGGAAGTGCTGGGAAAGG - Intergenic
1034075236 7:148225253-148225275 GAAAAGGGAGGGCCTGGCCAAGG + Intronic
1034345718 7:150384136-150384158 GTGCGCGGAGGGCCGGGCCAGGG + Intronic
1034902553 7:154916373-154916395 GTGCTGGGAAGGGGTGGCCTGGG - Intergenic
1035333942 7:158113818-158113840 GTGCCTCGAAGTCCTGGCCAAGG - Intronic
1035879769 8:3233335-3233357 GTGCAGGCATCGCCTGGCGAGGG - Intronic
1036662314 8:10716243-10716265 GCCCAGGGAAGGGCTGGCCCAGG - Intergenic
1037835753 8:22213902-22213924 GTCCAGGGTAGGCCCAGCCAGGG + Intergenic
1037904905 8:22710542-22710564 TTCCAGGGATCGCCTGGCCAGGG + Intergenic
1038018937 8:23536761-23536783 ATGCAGGGAAGGCCTGCCTGTGG + Intronic
1038150790 8:24941350-24941372 GCAAGGGGAAGGCCTGGCCAAGG - Intergenic
1038893558 8:31755101-31755123 GAGCAGTGCAGGCCTGTCCAGGG - Intronic
1039076313 8:33693391-33693413 GGGCAGGGAAGTCCTGGGAAGGG - Intergenic
1041632950 8:60108668-60108690 GGGCAGGGAAGGCCTGCCATGGG + Intergenic
1042531980 8:69825258-69825280 GTGTTGGGAAGTTCTGGCCAGGG + Intronic
1042787547 8:72566407-72566429 GTGTAGGCAAGGGCTGGGCACGG + Intronic
1043486833 8:80705995-80706017 GTGCAGGGGCGGCATGGCCCAGG + Intronic
1044286855 8:90419968-90419990 ATGCGGGGAAGGGCAGGCCATGG + Intergenic
1045244539 8:100431414-100431436 GGGAAGGGGAGGTCTGGCCAGGG + Intergenic
1045888560 8:107127568-107127590 GAGCAGGGGGGCCCTGGCCATGG + Intergenic
1047775527 8:128067392-128067414 GTGGAAGGAAGGACTGGCCTTGG - Intergenic
1048238408 8:132715994-132716016 CAGCAGGGGAGGCCTGGCCAGGG + Intronic
1049288375 8:141788778-141788800 GTGCAGGGCAGGCATGGCCAGGG + Intergenic
1049365811 8:142236349-142236371 GGGCAGGAAGAGCCTGGCCAGGG + Intronic
1049369664 8:142257759-142257781 TGGCAGGGGTGGCCTGGCCAGGG - Intronic
1049531327 8:143157068-143157090 GGGCAGGGAAGACTTGGCCTGGG - Intergenic
1049577664 8:143397190-143397212 CTGGAGGGCAGGCCTGGCCCAGG - Intergenic
1049787517 8:144458023-144458045 ATGCAGGCAAGGCCTCACCAGGG + Intronic
1049798248 8:144506166-144506188 GGGCGAGGAGGGCCTGGCCATGG - Intronic
1050636083 9:7614687-7614709 GAGCAGGGAAGGCCTGGGGGAGG - Intergenic
1052854409 9:33398236-33398258 GTGCAGGAATGGGCTGGCCACGG + Intronic
1052956100 9:34254289-34254311 GTGCAGGGAGGACCTGGCAGAGG + Exonic
1053682414 9:40494397-40494419 GTGCAGGAATGGGCTGGCCACGG + Intergenic
1053932397 9:43122723-43122745 GTGCAGGAATGGGCTGGCCACGG + Intergenic
1054281300 9:63130532-63130554 GTGCAGGAATGGGCTGGCCACGG - Intergenic
1054295513 9:63329897-63329919 GTGCAGGAATGGGCTGGCCACGG + Intergenic
1054393533 9:64634401-64634423 GTGCAGGAATGGGCTGGCCACGG + Intergenic
1054428182 9:65139615-65139637 GTGCAGGAATGGGCTGGCCACGG + Intergenic
1054502198 9:65881929-65881951 GTGCAGGAATGGGCTGGCCACGG - Intronic
1056938615 9:90936866-90936888 GTGATGGGAAGGGCTGCCCAGGG + Intergenic
1057080465 9:92171116-92171138 GTGCACAAAGGGCCTGGCCAGGG - Intergenic
1057232947 9:93335858-93335880 ACGCAGGGAAGGCCTTACCACGG + Exonic
1057252565 9:93515763-93515785 ACGCAGGGAAGGCCTTACCACGG - Exonic
1057263912 9:93601653-93601675 GTGCAGGGAGGGCCTCAGCAAGG + Intronic
1057784496 9:98076337-98076359 GGGCAGGTAGGGTCTGGCCAGGG + Intronic
1057802721 9:98199797-98199819 CAGCAGGGAAGGGCTGGTCAGGG + Intronic
1058907819 9:109495917-109495939 GTGCAGGAAAGGGCAGGCCCTGG - Intronic
1059388212 9:113981796-113981818 GTGAAGGAAAGGCATGGCCAAGG - Intronic
1059727696 9:117025509-117025531 TTGCAGGGAATGGCTGGCCCTGG + Intronic
1060183153 9:121547568-121547590 GAGCAGAGAAAGCCAGGCCATGG + Intergenic
1060972243 9:127744920-127744942 GTGACGGGGAGGCCTTGCCAAGG + Exonic
1061225860 9:129280709-129280731 GCTCAGGCAGGGCCTGGCCAGGG - Intergenic
1061424057 9:130488371-130488393 CTGCAGGGCAGGCTTGCCCAAGG + Intronic
1061701266 9:132417693-132417715 GTGCAGGCAGGGTCTGGCCCAGG + Intronic
1061874816 9:133538419-133538441 GTGCAGGTGAGGCCCGGCCCGGG + Exonic
1061971058 9:134045730-134045752 GTGAAGGGAAGCTCTGGACAAGG - Intronic
1062583160 9:137237137-137237159 GTCCCGGGAAGGCCTGTCCGTGG + Intergenic
1186447797 X:9646641-9646663 TTGGAGGGATGGCCTGGACAAGG - Intronic
1186479262 X:9883656-9883678 GTGAGGGCAAGACCTGGCCAGGG + Intronic
1186515931 X:10166075-10166097 GTGAAGGGAAGGCCAGGCTGTGG + Intronic
1189796575 X:44651531-44651553 GTGCAAGGAAGGCAGAGCCAAGG - Intergenic
1190640931 X:52482367-52482389 ATGCAGGGAAGGCCCAGGCAGGG - Intergenic
1190646741 X:52530498-52530520 ATGCAGGGAAGGCCCAGGCAGGG + Intergenic
1191766655 X:64705559-64705581 GGGCAGGGAAGTCCTGGAAAGGG - Intergenic
1196982737 X:121232544-121232566 GTGCAGGGTAGCCCTGTGCAGGG + Intergenic
1198420722 X:136468935-136468957 GTACATGGAAGGCCTGGGCTTGG - Intergenic
1198692077 X:139295314-139295336 CTTCAAGGAAGGCCTGGTCAAGG + Intergenic
1200038956 X:153352120-153352142 CTGGGAGGAAGGCCTGGCCATGG + Exonic
1200077310 X:153557542-153557564 GTGCTGGGAAGGACTGGGCTGGG - Intronic
1200424982 Y:3010072-3010094 CAGCAGGGGAGGCGTGGCCAGGG - Intergenic