ID: 1077517176

View in Genome Browser
Species Human (GRCh38)
Location 11:3008989-3009011
Sequence CTCCCGGGCCACACTCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 234}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077517165_1077517176 19 Left 1077517165 11:3008947-3008969 CCACCCGCCATGGGTGATCATCA 0: 1
1: 0
2: 0
3: 1
4: 63
Right 1077517176 11:3008989-3009011 CTCCCGGGCCACACTCCCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 234
1077517161_1077517176 26 Left 1077517161 11:3008940-3008962 CCCCAGCCCACCCGCCATGGGTG 0: 1
1: 1
2: 3
3: 22
4: 227
Right 1077517176 11:3008989-3009011 CTCCCGGGCCACACTCCCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 234
1077517164_1077517176 20 Left 1077517164 11:3008946-3008968 CCCACCCGCCATGGGTGATCATC 0: 1
1: 0
2: 0
3: 0
4: 48
Right 1077517176 11:3008989-3009011 CTCCCGGGCCACACTCCCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 234
1077517168_1077517176 12 Left 1077517168 11:3008954-3008976 CCATGGGTGATCATCAGAGCAGG 0: 1
1: 0
2: 1
3: 14
4: 142
Right 1077517176 11:3008989-3009011 CTCCCGGGCCACACTCCCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 234
1077517162_1077517176 25 Left 1077517162 11:3008941-3008963 CCCAGCCCACCCGCCATGGGTGA 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1077517176 11:3008989-3009011 CTCCCGGGCCACACTCCCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 234
1077517163_1077517176 24 Left 1077517163 11:3008942-3008964 CCAGCCCACCCGCCATGGGTGAT 0: 1
1: 0
2: 0
3: 12
4: 108
Right 1077517176 11:3008989-3009011 CTCCCGGGCCACACTCCCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 234
1077517166_1077517176 16 Left 1077517166 11:3008950-3008972 CCCGCCATGGGTGATCATCAGAG 0: 1
1: 0
2: 0
3: 9
4: 131
Right 1077517176 11:3008989-3009011 CTCCCGGGCCACACTCCCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 234
1077517167_1077517176 15 Left 1077517167 11:3008951-3008973 CCGCCATGGGTGATCATCAGAGC 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1077517176 11:3008989-3009011 CTCCCGGGCCACACTCCCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077517176 Original CRISPR CTCCCGGGCCACACTCCCTG GGG Intronic