ID: 1077517176

View in Genome Browser
Species Human (GRCh38)
Location 11:3008989-3009011
Sequence CTCCCGGGCCACACTCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 234}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077517161_1077517176 26 Left 1077517161 11:3008940-3008962 CCCCAGCCCACCCGCCATGGGTG 0: 1
1: 1
2: 3
3: 22
4: 227
Right 1077517176 11:3008989-3009011 CTCCCGGGCCACACTCCCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 234
1077517165_1077517176 19 Left 1077517165 11:3008947-3008969 CCACCCGCCATGGGTGATCATCA 0: 1
1: 0
2: 0
3: 1
4: 63
Right 1077517176 11:3008989-3009011 CTCCCGGGCCACACTCCCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 234
1077517168_1077517176 12 Left 1077517168 11:3008954-3008976 CCATGGGTGATCATCAGAGCAGG 0: 1
1: 0
2: 1
3: 14
4: 142
Right 1077517176 11:3008989-3009011 CTCCCGGGCCACACTCCCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 234
1077517166_1077517176 16 Left 1077517166 11:3008950-3008972 CCCGCCATGGGTGATCATCAGAG 0: 1
1: 0
2: 0
3: 9
4: 131
Right 1077517176 11:3008989-3009011 CTCCCGGGCCACACTCCCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 234
1077517164_1077517176 20 Left 1077517164 11:3008946-3008968 CCCACCCGCCATGGGTGATCATC 0: 1
1: 0
2: 0
3: 0
4: 48
Right 1077517176 11:3008989-3009011 CTCCCGGGCCACACTCCCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 234
1077517163_1077517176 24 Left 1077517163 11:3008942-3008964 CCAGCCCACCCGCCATGGGTGAT 0: 1
1: 0
2: 0
3: 12
4: 108
Right 1077517176 11:3008989-3009011 CTCCCGGGCCACACTCCCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 234
1077517162_1077517176 25 Left 1077517162 11:3008941-3008963 CCCAGCCCACCCGCCATGGGTGA 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1077517176 11:3008989-3009011 CTCCCGGGCCACACTCCCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 234
1077517167_1077517176 15 Left 1077517167 11:3008951-3008973 CCGCCATGGGTGATCATCAGAGC 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1077517176 11:3008989-3009011 CTCCCGGGCCACACTCCCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077517176 Original CRISPR CTCCCGGGCCACACTCCCTG GGG Intronic
900641986 1:3691897-3691919 CACCCTGGTCACACTGCCTGGGG - Intronic
900901298 1:5518114-5518136 CTCCCAGGACCCCCTCCCTGTGG + Intergenic
901063006 1:6482019-6482041 GTTCCGGGACACACTCCCTCAGG + Intronic
901239662 1:7685654-7685676 CTCCCTGCCCACGCTCCCTGAGG + Intronic
902466896 1:16624107-16624129 GGCCAGGCCCACACTCCCTGGGG + Intergenic
902507704 1:16948667-16948689 GGCCAGGCCCACACTCCCTGGGG - Intronic
904006116 1:27364170-27364192 CTCCTGGAGCACCCTCCCTGGGG + Intronic
904044124 1:27600174-27600196 CTCCCCCGCCCCCCTCCCTGGGG + Intronic
904756158 1:32769976-32769998 CACCCGGGCCCCCATCCCTGAGG - Exonic
905178356 1:36151926-36151948 CTCCCAGGGCCCACTCCCTGTGG - Intronic
905292788 1:36934235-36934257 CTCCTGGGCCTCCCTCCCTCTGG + Intronic
905403921 1:37720767-37720789 CCCCAGGGCCACTCACCCTGAGG + Exonic
905874579 1:41423826-41423848 CTCCCAGGCCACCCTCGCAGAGG + Intergenic
906147279 1:43567552-43567574 CTCATGGGCCACAGTCCCTTTGG + Intronic
909585424 1:77282682-77282704 CGGCCGGGCCGCACTCTCTGGGG + Intronic
911050308 1:93665285-93665307 TTTCAGGGCCACCCTCCCTGGGG - Intronic
912382417 1:109254661-109254683 CCTTCAGGCCACACTCCCTGGGG - Intronic
913256429 1:116958278-116958300 CTTCTGGGTCACATTCCCTGTGG + Intronic
914824576 1:151132157-151132179 CGCCCGGGGCACAGTCTCTGGGG + Exonic
915102990 1:153514059-153514081 CTCCCTACCCACAGTCCCTGTGG + Intergenic
916578384 1:166086948-166086970 CACCTGGGCCACACTGCATGTGG - Intronic
918077114 1:181178885-181178907 CTCCTGTGCCCCACTGCCTGGGG + Intergenic
919741629 1:200984599-200984621 CTGCCCGGCCCCAATCCCTGTGG + Intronic
921341450 1:214138424-214138446 CTCCCTGGTCAGGCTCCCTGGGG - Intergenic
922056276 1:222045372-222045394 CTCCCATGCCACACTCTTTGAGG - Intergenic
922321342 1:224490439-224490461 CTCCTGGGCCACATCCCATGGGG - Intronic
922765259 1:228153058-228153080 ATCCCGGGCCTGGCTCCCTGGGG + Intronic
1066439407 10:35424026-35424048 CTCTGTGGCCACACTGCCTGGGG + Intronic
1067570726 10:47369110-47369132 CTCCAGGGCCCACCTCCCTGAGG + Intronic
1069556443 10:69401554-69401576 CTGCCGGGCCTCCCTCCCGGGGG + Exonic
1070853179 10:79584225-79584247 CTCCCAGGCCACACATGCTGAGG + Intergenic
1072626680 10:97116677-97116699 CACCTGGGCCCCTCTCCCTGGGG - Intronic
1075586601 10:123663097-123663119 TTCCTGGGCCACACCCCCTGGGG - Intergenic
1075643879 10:124084968-124084990 CCCTCGGCCCACACTCCCCGGGG + Intronic
1076006233 10:126949844-126949866 CTCTCTGGCCACTCTCCCTTTGG - Intronic
1076801977 10:132835131-132835153 CTCCCAGGCCAAGCTCCATGTGG - Intronic
1077405237 11:2379631-2379653 CGCCCTGGCGACACTCCCAGGGG - Intronic
1077517176 11:3008989-3009011 CTCCCGGGCCACACTCCCTGGGG + Intronic
1077552099 11:3205018-3205040 CCCCCGAGCCACCCTCCCTCAGG - Intergenic
1077672213 11:4167018-4167040 TTTCAGGGCCACACTCCCTCCGG + Intergenic
1077892727 11:6431209-6431231 CTCCTGGGCTGCACTCACTGAGG - Exonic
1078563051 11:12389834-12389856 CTCCCCAGAAACACTCCCTGAGG - Intronic
1078664488 11:13313402-13313424 CTCCCAGTCCACACTCCTAGTGG + Intronic
1081640680 11:44751343-44751365 CTCCAGGGCCAGGCTGCCTGGGG + Intronic
1084732718 11:71083715-71083737 CTCCAGGACCACACCCCCTGTGG + Intronic
1084956439 11:72694053-72694075 CTCCCATCCCACCCTCCCTGTGG + Intronic
1087058363 11:93955193-93955215 CAGCAGGGCCACACTCCCTCTGG - Intergenic
1089699226 11:120234421-120234443 CTCCCGGACCTCCCTCTCTGGGG + Intergenic
1089729476 11:120511550-120511572 CTCCCGGGCGACGCTCCGAGGGG + Intergenic
1090628047 11:128622907-128622929 CTCCCTGGACACACTCCCTTCGG + Intergenic
1091336120 11:134767512-134767534 CTCAAGGGCCACAATCCCTACGG - Intergenic
1092282386 12:7108205-7108227 CTCCCTGGCCACAGTCCTGGCGG + Intronic
1098230209 12:68365404-68365426 CTTCCCGGCCAGACTTCCTGTGG - Intergenic
1098385007 12:69909312-69909334 CTCCCTTGACAGACTCCCTGAGG - Intronic
1098991378 12:77067699-77067721 TCCCAGGGCCACACTCCCTCTGG + Intergenic
1100714370 12:97290186-97290208 CTTCTAGGCCCCACTCCCTGAGG + Intergenic
1101904514 12:108814777-108814799 CTCCCAGGTCCCTCTCCCTGTGG - Intronic
1102651168 12:114443718-114443740 CACCTGGGCCACACTCACGGAGG + Intergenic
1104692673 12:130838864-130838886 CTCCCGGGACCCCCGCCCTGGGG + Intronic
1104815650 12:131644165-131644187 CTTCAGGGCCACAGTCACTGGGG - Intergenic
1113679791 13:112235206-112235228 CTCCATGGCCACATTCACTGTGG + Intergenic
1113737621 13:112689864-112689886 CGCCCGGGCCCCAGACCCTGGGG - Intergenic
1114541242 14:23461101-23461123 CAACAGGGCCACACTCCCTCTGG - Intergenic
1122162238 14:99793163-99793185 CGCCCGGGCCGCGCTCCCCGCGG + Intronic
1122458845 14:101879091-101879113 CTCCCTGGCCAGGCTGCCTGGGG - Intronic
1123716703 15:23039183-23039205 GTCCCGGGTAACACGCCCTGTGG + Intronic
1127291919 15:57578986-57579008 CCCCCAGCCTACACTCCCTGGGG + Intergenic
1127812517 15:62576928-62576950 CTCCCAGACCTCACTCCCTGGGG - Intronic
1129274237 15:74434650-74434672 CCCCCGTGCCCCACTCACTGTGG + Intergenic
1129880317 15:79002318-79002340 CTCCTGGTCCACACACCCTGGGG + Intronic
1132666817 16:1084778-1084800 CTCTCCGGCCACCCTCTCTGGGG - Intergenic
1132696735 16:1205283-1205305 TTCCCGGGCCCCTCTTCCTGGGG - Intronic
1133224837 16:4336078-4336100 CGCCCAGGCAGCACTCCCTGTGG + Intronic
1133763904 16:8821872-8821894 CTCCCTGGCTAGAGTCCCTGGGG - Intronic
1134815250 16:17200324-17200346 CTCTAGGGCCACACGCTCTGTGG + Intronic
1137777819 16:51071188-51071210 GAGCAGGGCCACACTCCCTGCGG - Intergenic
1138137065 16:54532325-54532347 CTCTTGGGCCACAATCCCAGAGG + Intergenic
1138516951 16:57541430-57541452 CTCCTGGGCTACACTCCCTCTGG - Intergenic
1139472885 16:67187620-67187642 CTCCCGTGCCAGCTTCCCTGCGG + Exonic
1139921260 16:70461780-70461802 CTTCCTGGGCACACTCCCTGGGG + Intronic
1141484881 16:84332114-84332136 CTCCCGGGGCACTTTCCCTTAGG + Intergenic
1141600616 16:85123978-85124000 CTCCCGGCCTTCCCTCCCTGCGG - Intergenic
1141679375 16:85535456-85535478 CTCCCGGGTCACACAGGCTGAGG - Intergenic
1142141370 16:88474223-88474245 CGCCCGGGCCACTGCCCCTGGGG + Intronic
1142338811 16:89507860-89507882 CTCCGGGGCTGCCCTCCCTGCGG + Intronic
1142671000 17:1487391-1487413 CTCGCGGACCCCGCTCCCTGGGG + Intronic
1142972779 17:3623930-3623952 CTGCCAGGACACACTCACTGCGG + Intronic
1142981986 17:3677664-3677686 CACGCGGGCCCCTCTCCCTGAGG + Intronic
1143101337 17:4506370-4506392 CCCACTGGCCACACCCCCTGTGG + Intronic
1143352451 17:6298706-6298728 CAGCAGGGCCACACTCCCTTTGG + Intergenic
1145778016 17:27543102-27543124 GTCCCTGTCCACACACCCTGTGG + Intronic
1145998055 17:29115673-29115695 CTCCCAGGCCACTCTCCTCGGGG + Exonic
1146526264 17:33569491-33569513 CTCCACTGCCTCACTCCCTGTGG - Intronic
1146944856 17:36866729-36866751 CTCCCAGCTCACCCTCCCTGGGG - Intergenic
1146945419 17:36870034-36870056 CTCCCAGCTCACCCTCCCTGGGG - Intergenic
1147121012 17:38335086-38335108 ATCCGAGGCCACACTCCCAGTGG - Exonic
1148216107 17:45834822-45834844 CTCCCTGACCACCCTGCCTGTGG + Exonic
1148227993 17:45912559-45912581 CAGCAGGGCCACACTCCCTCTGG - Intronic
1149347287 17:55751302-55751324 CTGCCGCCCCGCACTCCCTGCGG - Intronic
1151320484 17:73349563-73349585 CTCCTAGGCCCTACTCCCTGTGG - Intronic
1151802091 17:76384663-76384685 CTCCCCGGCCTCGCTCCCTCCGG - Exonic
1152121886 17:78423872-78423894 CTCACAGCCCACACTCCCTGGGG - Exonic
1153201898 18:2655716-2655738 CTCCTGCGCCACAGTCCCGGCGG + Exonic
1154097575 18:11432374-11432396 TGCCCGAGCCACCCTCCCTGCGG - Intergenic
1155259976 18:24032134-24032156 CGGCAGGGCCACACTCCCTGGGG - Intronic
1156072407 18:33228780-33228802 CTGCCTGGAAACACTCCCTGTGG - Intronic
1157496717 18:48161843-48161865 CTCCCGGGCGCCCCTCCCCGCGG + Intronic
1160025478 18:75211938-75211960 CTCCCGGCGCCCACTCCCCGCGG - Intronic
1160062880 18:75548730-75548752 CACTCTGGGCACACTCCCTGTGG + Intergenic
1160837628 19:1132163-1132185 CTCCCGGGCAGCGCTTCCTGGGG - Intronic
1160868523 19:1266660-1266682 CTCCCGGGCCTCCTCCCCTGCGG - Intronic
1160891317 19:1380152-1380174 CTCATGGGCCCCACTGCCTGAGG + Intergenic
1161029675 19:2051789-2051811 CCCCTGGGCCACCCTGCCTGGGG + Intergenic
1162824858 19:13245084-13245106 CTTCCGGGACACACTGCCTCTGG + Intronic
1163282549 19:16326177-16326199 CTCCCGAGCCACGCCTCCTGGGG - Intronic
1163411021 19:17154544-17154566 CTATTGGGCCACACTCCCTATGG - Intronic
1163591382 19:18196018-18196040 GTCCAGGGCCACACAGCCTGGGG - Exonic
1164674219 19:30091088-30091110 CTCCCGGGCCCCACTCCTCCTGG - Intergenic
1165146863 19:33736380-33736402 CTCCCAGGCCTGCCTCCCTGTGG + Intronic
1165408361 19:35643816-35643838 CTCCCGGGCCCCGCCCCCTTAGG - Intronic
1167472799 19:49684837-49684859 CTCCCGGGCCGCGCTCACAGTGG - Exonic
1167769391 19:51505007-51505029 CTCCCAGGCCACCCTCCCCCAGG + Intergenic
1167812581 19:51847547-51847569 CTCCCAGGCCTCTCTCTCTGTGG + Intergenic
1168062092 19:53898766-53898788 CCCCCCGGCCACGCCCCCTGAGG - Intronic
1168081941 19:54016456-54016478 CTCCCTGACCACACTCCGAGTGG + Intergenic
1168145385 19:54417079-54417101 CCCCCGGGCCAGTGTCCCTGAGG - Intronic
925178056 2:1798669-1798691 CTTCCTGGCCATGCTCCCTGAGG + Intronic
925271258 2:2609393-2609415 CTCACTGGCCACAAACCCTGGGG + Intergenic
925839607 2:7979271-7979293 CTCCCTGGCTACACACACTGAGG - Intergenic
926316536 2:11714490-11714512 CTCCCTCGCCCCACTCCCAGAGG + Intronic
927215942 2:20667824-20667846 CTCCCGGGGCCCAGTCCCAGAGG + Intronic
929934451 2:46284462-46284484 CTCCTGGCTCACACTCTCTGTGG - Intergenic
930618973 2:53624837-53624859 CTCATGAGCCACACTCCGTGGGG - Intronic
931214249 2:60226544-60226566 CAGCAGGGCCACACTCCCTTAGG + Intergenic
932480378 2:72035673-72035695 ATCCGGGGTCACACTTCCTGTGG - Intergenic
933729735 2:85447503-85447525 CTCCCGGCCAACCCTCCCAGCGG + Intergenic
934758846 2:96842398-96842420 CTCCCGGGCCACAGCCTCTTGGG + Exonic
937097563 2:119245619-119245641 CTCCCTGGCCACACGCCTGGTGG + Exonic
937295300 2:120806545-120806567 CTCCCTCCCCACACTCCCAGGGG - Intronic
937992514 2:127672529-127672551 CTCCCGAGCCCCACCCTCTGTGG + Intronic
941638993 2:167967345-167967367 CTTGAGGGCCACAGTCCCTGGGG - Intronic
942145914 2:173026077-173026099 CTCTTGGGACACACTGCCTGGGG - Intronic
943060452 2:183037800-183037822 GTCCCGGGCGCCTCTCCCTGTGG - Intronic
945119597 2:206443835-206443857 CTCCCGGGCGCCGCTCCGTGTGG - Exonic
946284399 2:218692272-218692294 CTCCCTGTCCACACTCCCCAAGG + Exonic
946335443 2:219032437-219032459 CTCCCTGCCCTCACTCGCTGTGG + Intronic
946690578 2:222305877-222305899 CTACCGGGCCGCACTCCCTGGGG - Intergenic
947541608 2:230983755-230983777 CAGCAGGGCCACACTCCCTCTGG + Intergenic
947573648 2:231255475-231255497 CTCCCTGACCAAACTCCCAGGGG - Intronic
947701992 2:232242351-232242373 CTCCCCACCCACACTCCCTCAGG - Intronic
948187772 2:236034897-236034919 CTCCCAAGCCCCACTCCCAGGGG - Intronic
948669881 2:239561535-239561557 CTGCCTGGCCACACGCTCTGCGG - Intergenic
1172119747 20:32591061-32591083 GGCCCGCGCCACACTGCCTGTGG + Intronic
1172223400 20:33288707-33288729 CTCCTGGGCCCTAATCCCTGGGG + Intronic
1172586495 20:36088899-36088921 CTCCTAGGCCACCCTCTCTGAGG - Intergenic
1172714207 20:36951188-36951210 CTCCCGGGACTGACTCCCCGAGG - Intronic
1172872443 20:38144137-38144159 CTCCCGGGACACCACCCCTGGGG - Intronic
1173877284 20:46381982-46382004 GGCTGGGGCCACACTCCCTGGGG + Intronic
1175920881 20:62450210-62450232 CACCCCGGCCACGCTGCCTGGGG + Intergenic
1176195483 20:63834878-63834900 CTCCCAGGCCATCCTTCCTGAGG - Intergenic
1176882610 21:14216041-14216063 CTCCAGGGCCACGCCCCCAGCGG - Intergenic
1178933369 21:36838876-36838898 CAGCAGGGCCACACTCCCTCTGG - Intronic
1179109625 21:38435124-38435146 GTCCCGGGCCAGCCTCCTTGTGG - Intronic
1179712823 21:43272947-43272969 CTCCCGGGCCCCTGTTCCTGGGG - Intergenic
1180007024 21:45027576-45027598 AGCCAGGGCCACACTGCCTGGGG - Intergenic
1180908359 22:19431560-19431582 CTCCCGCGCCACCCGCCCTCCGG + Exonic
1181547978 22:23614820-23614842 CTCCTGTGTCACTCTCCCTGAGG + Intronic
1182149092 22:28016169-28016191 CTCCCTGGCCTCACTCACTCTGG + Intronic
1183193397 22:36336322-36336344 ATCCCGGGCCAGACCCTCTGGGG - Intronic
1184009453 22:41736048-41736070 CAGCAGGGCCACACTCCCTTTGG + Intronic
1184468694 22:44683615-44683637 CTCCCAGGCCACCCTGCCTTAGG + Intronic
950925934 3:16742061-16742083 CTCCTGGGCCTCTCTCCGTGTGG + Intergenic
951133677 3:19077977-19077999 CTCCCTGGCCACTGCCCCTGTGG + Intergenic
954433204 3:50482292-50482314 CTCCTGGGCCACCTTCCCTGGGG + Intronic
955233502 3:57120297-57120319 CTGGCTGGCCCCACTCCCTGTGG + Exonic
956500325 3:69875877-69875899 CTCATGGCACACACTCCCTGCGG - Intronic
957051496 3:75415581-75415603 CTGCAGGTCCACACACCCTGAGG + Intergenic
957717424 3:83946760-83946782 CTGCAGGGCCACACTCCCTCTGG - Intergenic
961157007 3:124688201-124688223 CTCCTGCCCCAGACTCCCTGAGG - Intronic
961609251 3:128123596-128123618 CTCCTGGCCCACAAGCCCTGAGG + Exonic
962722361 3:138187681-138187703 CTCCTGGGCACCACCCCCTGGGG + Intronic
962751113 3:138435265-138435287 CTCCCGGGGCGCAGACCCTGGGG + Intronic
963870664 3:150410290-150410312 CCCCCGGGCCCCGCTCCCTGGGG - Exonic
968001921 3:195212178-195212200 CACCTGGGCCACTCTCCCGGTGG - Intronic
968282137 3:197485074-197485096 CTCCCGGGCTCCGCTCCCTGTGG + Intergenic
968315140 3:197717587-197717609 CTGCAGGGCCACACACCCTCTGG - Intronic
969007880 4:4036356-4036378 CTGCCTGGCCACTCCCCCTGAGG + Intergenic
969427593 4:7134785-7134807 CTCCCTGGCCTCTCTCCCTGTGG + Intergenic
970853270 4:20626817-20626839 CTCCCTGGGCACACCTCCTGAGG - Intergenic
977294855 4:95199000-95199022 CTCCAGGGCCTCACTCCCACAGG - Intronic
984782892 4:183541894-183541916 CTGCATGGCCACCCTCCCTGAGG - Intergenic
985005914 4:185535394-185535416 CTCCCGGGCCCTGCGCCCTGGGG - Exonic
986093726 5:4536012-4536034 CAGCAGGGCCACACTCCCTGAGG - Intergenic
986304962 5:6508045-6508067 CTTCAGAGCCCCACTCCCTGTGG - Intergenic
986444522 5:7809943-7809965 TTCCCTGAGCACACTCCCTGAGG + Intronic
986622601 5:9691333-9691355 CAGCGGGGTCACACTCCCTGTGG - Intronic
986744485 5:10731591-10731613 CTGCCCGGCCACACTGCCTGTGG + Intronic
989654726 5:43734211-43734233 CTGCCTGGCCACACTGCCTTGGG + Intergenic
992499381 5:77327129-77327151 CTCCCAGCACACATTCCCTGGGG + Intronic
994166596 5:96615596-96615618 CTCCCTGGCCTCCTTCCCTGGGG - Intronic
997114582 5:131112511-131112533 CCCCCGGGCCCCACACCTTGAGG + Intergenic
997392165 5:133526034-133526056 CTCACGGGACACACACACTGAGG + Intronic
999176989 5:149638763-149638785 CCCCCGGGCCAGCCTGCCTGAGG - Intergenic
1000291009 5:159871442-159871464 CAGCAGGGCCACACTTCCTGTGG + Intergenic
1002559624 5:180072303-180072325 CTCCCGGGCTCCACGCCCTGCGG - Intergenic
1002710548 5:181192258-181192280 CTCCCCCGCCACACTCCCGCTGG - Intergenic
1003092986 6:3119413-3119435 ATCCTGGGCCTCACTCCCAGAGG + Intronic
1003766653 6:9244862-9244884 CTCCCTGGCCAAACCCCATGGGG - Intergenic
1005822204 6:29607292-29607314 CTCCCTGCCCACTCTCCCTTAGG - Intronic
1005970338 6:30756028-30756050 CTCCCTGCCCAGACTCCTTGTGG + Intergenic
1005995105 6:30926043-30926065 CTCCTGGCCCACATTCCCTCAGG - Intronic
1006394174 6:33776360-33776382 CTCCAGTGACACACTCCTTGAGG - Intronic
1012487523 6:99738826-99738848 CTCTCAGGCCACACTCCTTTAGG + Intergenic
1013626601 6:111943860-111943882 TTCCCCTGCCCCACTCCCTGGGG + Intergenic
1014501459 6:122195217-122195239 CATCAGGGCCACACTCCCTCCGG - Intergenic
1017816965 6:158022879-158022901 CTCCCGGGCCACCGTCAGTGTGG - Intronic
1018429511 6:163712499-163712521 CTCCCCTCCAACACTCCCTGGGG - Intergenic
1018908143 6:168087012-168087034 CTCCCCGCTCACACTCCCTTGGG + Intergenic
1019170630 6:170131421-170131443 CACCCGGGCCACGGTCCCAGAGG + Intergenic
1021877780 7:25064582-25064604 CTCCCTGACCACACTCTCTAAGG - Intergenic
1028970932 7:96858315-96858337 CTCCCGGGCCAAAAGCACTGTGG + Intergenic
1030996264 7:116362012-116362034 CTCCAAGGCCACATTTCCTGTGG + Intronic
1032491166 7:132325674-132325696 CAGCAGGGCCACACTCCTTGAGG - Intronic
1032567076 7:132957440-132957462 ATCCCGGGGCACACACCCTCTGG + Intronic
1034405000 7:150897188-150897210 ATCCCTGGCCACACCCCTTGGGG + Intergenic
1034972451 7:155427688-155427710 CCCCCCAGCCACACTCCCTACGG + Intergenic
1036492985 8:9244921-9244943 ATCCCGGGCCAGTCTCCCTGGGG - Intergenic
1036722796 8:11192727-11192749 CTCCCTGGCCCAACTCCCTGAGG + Intronic
1040109348 8:43559911-43559933 CCGCCTGGCCACTCTCCCTGAGG + Intergenic
1043803196 8:84637702-84637724 ATCCCAGTCCACACTCCCGGAGG - Intronic
1044726892 8:95201579-95201601 CTCCTGATCCCCACTCCCTGTGG - Intergenic
1045942497 8:107755338-107755360 CGCCCTGGCCACATTCCCTTCGG - Intergenic
1047237722 8:123056994-123057016 CTCCTCGGGCACCCTCCCTGAGG - Intronic
1048164331 8:132048930-132048952 CTCCCAACCCACACACCCTGTGG - Intronic
1048306915 8:133290873-133290895 CTCCCGGGGCAACCTCCTTGAGG - Intronic
1049216301 8:141409867-141409889 CTGCGGGGGCCCACTCCCTGGGG + Intronic
1049755017 8:144307312-144307334 CTCCAGGGCCCCATTCCCAGAGG - Intronic
1053110779 9:35457931-35457953 GTCCTGGGCCACAATCCCAGGGG - Intergenic
1053141537 9:35685613-35685635 CTCCCGGACCATCCTCCCCGAGG + Intronic
1056461329 9:86812339-86812361 CTCTCTGGAAACACTCCCTGTGG - Intergenic
1057054440 9:91949965-91949987 TTCCCGGCCCCCACTGCCTGCGG - Exonic
1059351275 9:113666893-113666915 CTCCAGGGCCAGACTGTCTGGGG + Intergenic
1060732290 9:126046412-126046434 CTGCAGGGCCAGCCTCCCTGTGG - Intergenic
1060920763 9:127418847-127418869 CTTCCAGACCACACTCCCAGAGG + Intergenic
1060932271 9:127496704-127496726 CTCTGGGGCCACACTGCTTGGGG - Intronic
1061421337 9:130474396-130474418 CTCTCCCGCCACACTTCCTGAGG - Intronic
1061512833 9:131071388-131071410 CTACCCTGCCACTCTCCCTGGGG - Intronic
1061555777 9:131367920-131367942 CTCCCAGCCAAAACTCCCTGTGG - Intergenic
1062385159 9:136306393-136306415 CTCCTGAGCCTCCCTCCCTGGGG + Intronic
1062630209 9:137459922-137459944 CTCCCGGGCCGAGGTCCCTGTGG - Intergenic
1185653559 X:1666713-1666735 TCTCAGGGCCACACTCCCTGTGG + Intergenic
1185853375 X:3509531-3509553 CTCCCGGGCCGAACTCCCGTCGG - Intergenic
1196826085 X:119741338-119741360 CTCTTGAGCCACACTGCCTGGGG + Intergenic
1196840306 X:119853164-119853186 CTCGCGGCCCAGACTCCCTCGGG + Intergenic
1200233536 X:154457971-154457993 CGCCCGCGCCACACCCCCTCGGG - Intergenic
1200287210 X:154834768-154834790 CTACAGGGCCCCACACCCTGAGG + Intergenic
1201147326 Y:11072472-11072494 CCCCTGGCCCACACTCCCAGAGG + Intergenic