ID: 1077521276

View in Genome Browser
Species Human (GRCh38)
Location 11:3036559-3036581
Sequence ACATTCCCACCCATAGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 2, 1: 0, 2: 13, 3: 55, 4: 269}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077521276_1077521279 12 Left 1077521276 11:3036559-3036581 CCATGCACTATGGGTGGGAATGT 0: 2
1: 0
2: 13
3: 55
4: 269
Right 1077521279 11:3036594-3036616 CCACTGCAGAAACAATACGGTGG 0: 1
1: 0
2: 1
3: 10
4: 71
1077521276_1077521277 9 Left 1077521276 11:3036559-3036581 CCATGCACTATGGGTGGGAATGT 0: 2
1: 0
2: 13
3: 55
4: 269
Right 1077521277 11:3036591-3036613 CAGCCACTGCAGAAACAATACGG 0: 1
1: 0
2: 5
3: 33
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077521276 Original CRISPR ACATTCCCACCCATAGTGCA TGG (reversed) Intronic
900560512 1:3303668-3303690 ACATTCCCACCAGTAGTGTGAGG + Intronic
901950341 1:12740333-12740355 ACATTCCCACCATGAGTGTACGG - Intergenic
902731136 1:18369620-18369642 ACTGTCTCACCCAGAGTGCAGGG - Intronic
905358828 1:37404340-37404362 TCATTCCCACCCCAAGTCCATGG - Intergenic
906237559 1:44221194-44221216 CCCCTCCCATCCATAGTGCATGG - Exonic
906359365 1:45139510-45139532 ATCTTCCCACCCAAAGTGCTGGG + Intronic
909592349 1:77364976-77364998 ACATTCCCAACAACAGTGTATGG + Intronic
909708561 1:78616886-78616908 ACATTCCCACCAGAAGTGTATGG - Intergenic
910384893 1:86671598-86671620 ACATTCCCACCAACAGTGTACGG - Intergenic
910512258 1:88020541-88020563 ACATTCCCACCAGTGGTGTATGG + Intergenic
911186782 1:94912412-94912434 CCATCCCCACCCAGAGGGCAAGG + Intronic
911653042 1:100411231-100411253 ACTTCGACACCCATAGTGCAAGG + Intronic
911975999 1:104495759-104495781 ACATTCCCACCAACAATGTATGG - Intergenic
912614916 1:111089549-111089571 CCATTTCCACCAATAGTGAATGG - Intergenic
912907716 1:113724153-113724175 ACATTTCCACCAACAGTGTACGG - Intronic
915818674 1:158997418-158997440 ACATTCTCACCAACAGTGTAAGG + Intergenic
916033073 1:160895307-160895329 CGATTACCACCCATAGTGCGAGG + Intergenic
916721979 1:167491199-167491221 ACCTTTCCGCCCACAGTGCACGG - Intronic
917476348 1:175372563-175372585 ACATTCTCACCTGCAGTGCAAGG + Intronic
918448409 1:184636241-184636263 TCATTGCCACCACTAGTGCAGGG - Intergenic
919093276 1:192998783-192998805 ACATTCCCAAGCACTGTGCATGG - Intergenic
919446029 1:197706810-197706832 ACATTCCCACCAACAGTGTGTGG - Intronic
919895483 1:202007370-202007392 TCATTCCCAACCCTTGTGCAGGG - Intergenic
920305100 1:205013714-205013736 ACATTCCCTCCCATAGCACTTGG - Intronic
923299000 1:232623174-232623196 ACACAGCCACCCGTAGTGCAAGG - Intergenic
923834972 1:237600974-237600996 ACATTCCCACCAACAGTGTATGG - Intronic
1063558131 10:7100146-7100168 ACACTCCCACCCAGCGTCCATGG + Intergenic
1063913039 10:10851984-10852006 ACATTCCCACCAGCAGTGTATGG - Intergenic
1064271868 10:13872502-13872524 ATTTTCCCACACATCGTGCATGG - Intronic
1065098345 10:22305865-22305887 ACATTCCCACCAGTATTGTATGG - Intergenic
1065370762 10:24982733-24982755 ACATTCCCATCCATTGTTCCTGG - Exonic
1065777987 10:29140147-29140169 ACATTGCCACCCATAGGGGTGGG - Intergenic
1066299261 10:34082401-34082423 ACATCCCCACCTGCAGTGCATGG - Intergenic
1070255281 10:74808607-74808629 ACGTCCCCACCCATAGGGCCTGG - Intergenic
1072879555 10:99212210-99212232 ACATTCCCACCAAGTATGCAAGG - Intronic
1073560833 10:104495423-104495445 ACATTTCCACCAACAGTGTATGG + Intergenic
1075358889 10:121811552-121811574 ACATTCCCAGACATAGCCCAAGG - Intronic
1075988839 10:126815202-126815224 ACCTTGCCTCCCAAAGTGCAGGG - Intergenic
1077521276 11:3036559-3036581 ACATTCCCACCCATAGTGCATGG - Intronic
1078535432 11:12169855-12169877 ATACTCCCACCAATAGTGCAAGG + Intronic
1079113517 11:17622950-17622972 ACATTCCCACCAAAAGTGTGAGG + Intronic
1079125181 11:17713965-17713987 CCCTTCCCACCCAGTGTGCAGGG - Intergenic
1079517153 11:21282558-21282580 ACATTCCCACCAACAGTGTTGGG - Intronic
1079520590 11:21321794-21321816 ACAGTCCCACACATGGTGTAAGG + Intronic
1080316085 11:30950231-30950253 ACATTCCCACCAACAGTGTAGGG - Intronic
1080601350 11:33823206-33823228 ACATTCCCACCAACAGTATACGG + Intergenic
1081294217 11:41365459-41365481 ACATCCCCACCCCTAGTCCATGG + Intronic
1085327705 11:75619923-75619945 ACATTCCCACCAACAGTGTATGG + Intronic
1085813948 11:79715920-79715942 ACATTCCCACCAATGGTAAACGG + Intergenic
1087145431 11:94806100-94806122 ACATGCCCACTGACAGTGCAGGG + Intronic
1087350523 11:97026100-97026122 ACATTCCCACCAACAATGTACGG - Intergenic
1087767906 11:102176495-102176517 ACATTGCCTCCCAAAGTGCTGGG - Intronic
1088405681 11:109475267-109475289 ACATTCCCACCAATAATGTTTGG - Intergenic
1089082181 11:115785912-115785934 ACATTCCCTCTCTTAGTTCATGG + Intergenic
1089734812 11:120543069-120543091 ACATTCCCACCAACAGTGTACGG - Intronic
1090122321 11:124044150-124044172 ACATTCTGAGCCATGGTGCATGG - Intergenic
1094300335 12:28957609-28957631 CCATTCCCACCCAGAAAGCAAGG + Intergenic
1094790567 12:33909102-33909124 ACATTTCCACCCATACTTCTTGG - Intergenic
1095491491 12:42739211-42739233 ACCTTCCCACCAACAGAGCATGG - Intergenic
1096910381 12:54977701-54977723 ACATTCTCACCCAAATTGCCAGG - Intronic
1099223107 12:79936926-79936948 AGATTCCCATCTATACTGCAAGG - Intergenic
1101542292 12:105676087-105676109 ACATTCCTGCCCATTGTCCAGGG - Intergenic
1101661447 12:106769220-106769242 ACATTGCCACCCAAAGCGCTGGG + Intronic
1101664353 12:106797048-106797070 ACATTCCCACCAGCAGTGTATGG - Intronic
1103817269 12:123668729-123668751 CCTTTGCCACCCAAAGTGCAGGG + Intergenic
1104225157 12:126824398-126824420 ACATTCCAACCAACAGTGTATGG + Intergenic
1104967453 12:132514623-132514645 ACAGTCCCGGCCATGGTGCAGGG + Intronic
1105530353 13:21213413-21213435 ACATTCCCACCAACAGTACAAGG - Intergenic
1107224124 13:38026567-38026589 ACATTCCCACCAACAGTGTATGG + Intergenic
1107347294 13:39475526-39475548 ACATGCCCACCAAAATTGCAAGG + Intronic
1108131719 13:47309164-47309186 ACATTCCCACCAACAGCGTACGG + Intergenic
1108232037 13:48355454-48355476 ACATTCCCACCAACAGTGTACGG - Intronic
1111159507 13:84375450-84375472 ACATTCCCACCAACAGTGTGCGG - Intergenic
1111394496 13:87647529-87647551 ACTTTCACACACATACTGCAAGG - Intergenic
1112741083 13:102473167-102473189 ACATTCCCACCAACAATGCACGG - Intergenic
1113248494 13:108425590-108425612 GCATTCCCTCACATAGTGTAAGG + Intergenic
1113295067 13:108950578-108950600 ACATTCCCACCAGCAATGCAGGG - Intronic
1116413436 14:44651733-44651755 ACATTCCCTTCAACAGTGCATGG - Intergenic
1116622263 14:47221170-47221192 ACATTCCCACCCAAACTTCTAGG - Intronic
1119953785 14:78773272-78773294 ACTCTCCCACCCATAGTCCCAGG - Intronic
1120107178 14:80509252-80509274 ACATTCCAACCAACAGTGTATGG + Intronic
1121477315 14:94221743-94221765 ATATTCCCACCAACAGTGTAAGG - Intronic
1121975538 14:98400409-98400431 ACATTCCCACCCATTGTCCAAGG - Intergenic
1123174587 14:106404435-106404457 ACATTCTCACTTAAAGTGCAAGG + Intergenic
1123329086 15:18807544-18807566 ACATTCCCTATCATAGAGCAGGG + Intergenic
1123334956 15:18905192-18905214 ACATTCCCATTCATACAGCAGGG + Intergenic
1123384975 15:19786152-19786174 ACATTCCCTTTCATAGAGCAGGG - Intergenic
1123686173 15:22798963-22798985 ACATTGCCACCCACAGTGTATGG - Intronic
1124572761 15:30881062-30881084 ACATTCCCACCAATAGTGTATGG + Intergenic
1125127684 15:36243162-36243184 ACATTCCCACCAGCAGTGTAAGG + Intergenic
1129085501 15:73085578-73085600 AAATTCCCACCAACAGTGTATGG + Intronic
1129271978 15:74423769-74423791 GTATTCCCACCCCTAGTGGAAGG - Intronic
1130420941 15:83746321-83746343 ACATGGCCACTCAGAGTGCAAGG + Intronic
1131320689 15:91387383-91387405 ACATTCCCACCAATAGTATATGG + Intergenic
1131658772 15:94491178-94491200 ACATTCCCACTAACAGTGTATGG - Intergenic
1135609220 16:23850730-23850752 ACATTCCCACCAACAGTGTATGG + Intronic
1136423483 16:30152580-30152602 ACATTCCCACCAACAGTGCACGG - Intergenic
1138477270 16:57279113-57279135 TCATTCCCACATATAGTGCTAGG + Intronic
1139555592 16:67707421-67707443 ACATTCCCACCAAGAATGTATGG - Intronic
1144761938 17:17711874-17711896 ACATTCCCACCCACAGGTCCCGG - Intronic
1145292699 17:21561910-21561932 ATATTCCCACCAACAATGCATGG + Intronic
1145387270 17:22424032-22424054 ACATTCCCACCAACAATGCATGG - Intergenic
1146603017 17:34234891-34234913 CCATTCCCACCCTTAGTCCCTGG + Intergenic
1146649721 17:34599129-34599151 TCACTCCCACCCATCTTGCAAGG - Intronic
1147586077 17:41654675-41654697 ACATTCCTGCCCACAGTGCAGGG + Intergenic
1150151939 17:62817078-62817100 ACATTCCCACCAACAGTGTATGG - Intergenic
1150194250 17:63278513-63278535 ACATTCCCACCAACAGTGTATGG - Intronic
1151163556 17:72185650-72185672 ACATGCTCACCCAGAGTGCATGG - Intergenic
1151949720 17:77344393-77344415 ACATTCCCACCAGCAGTGCACGG - Intronic
1152191837 17:78892872-78892894 ACAATCCCACCCAAAGGGCAAGG + Intronic
1153721517 18:7908179-7908201 ATATTCCCACCAGCAGTGCATGG + Intronic
1154300787 18:13190594-13190616 ACATTCCTACAAATAATGCAAGG - Intergenic
1154387470 18:13907915-13907937 ACCTTCCCACCAACAGTGTACGG - Intronic
1154671675 18:17344992-17345014 ACATTCCCTATCATAGAGCAGGG + Intergenic
1154693104 18:17638468-17638490 ACATTCCCTATCATAGAGCAGGG + Intergenic
1154753825 18:18471242-18471264 ACATTCCCTATCATAGAGCAGGG + Intergenic
1154778393 18:18807989-18808011 ACATTCCCTATCATAGAGCAGGG + Intergenic
1154903460 18:20530796-20530818 ACATTCCCTATCATAGAGCAGGG + Intergenic
1154921476 18:20812964-20812986 ACATTCCCTTTCATAGAGCAGGG + Intergenic
1154922281 18:20825706-20825728 ACATTCCCTTTCATAGAGCAGGG - Intergenic
1155773585 18:29730275-29730297 ACATTCCCACCAACAGTGTATGG - Intergenic
1157185974 18:45540333-45540355 ACATTCCCACCCCCAGTGCGCGG + Intronic
1157223580 18:45843519-45843541 ACATTCCCACCAATAGTATATGG - Intronic
1158544094 18:58381236-58381258 AGACTCCCACCCACAGTGAAGGG + Intronic
1158727515 18:59986997-59987019 ACATTCCCACATATACAGCATGG - Intergenic
1158859516 18:61578809-61578831 ACATTCCCATCCTTAGACCAGGG + Intergenic
1159636933 18:70816349-70816371 TCATTTCCACCCATACTACACGG + Intergenic
1161975490 19:7606056-7606078 AAAGTCCCACCCATCGTGCGTGG + Intronic
1162170974 19:8788627-8788649 ACTTGCCCACCCATTGTGCTGGG - Intergenic
1162870590 19:13583435-13583457 AAATTCCCACCCATACTCCGAGG - Intronic
1163062936 19:14773452-14773474 ACAATCCCTCCCAAAGTGCTGGG + Intronic
1165345539 19:35246833-35246855 ACATTCCCACCAGCAATGCACGG - Intergenic
1166238100 19:41471007-41471029 ACATTCCTCCCCATATGGCAGGG - Intergenic
1167111779 19:47466628-47466650 GCATTCCCACCAGCAGTGCATGG - Intronic
926871037 2:17417356-17417378 ACACTGCCACCCACAGTGGATGG - Intergenic
928053798 2:28029804-28029826 ACATTCCCATCAACAGTGCATGG + Intronic
928201912 2:29252783-29252805 CCATTCACACCCAAAGTGAATGG - Intronic
929211632 2:39364049-39364071 ACATTCCCATCAACAGTGGACGG - Intronic
929711239 2:44268943-44268965 ACAATCCCACTAACAGTGCACGG - Intergenic
931258197 2:60593357-60593379 GCATTCCCACCAACAGTGTATGG - Intergenic
931595426 2:63937527-63937549 ACATTTCCACCAATAGTGCAGGG - Intronic
931722412 2:65076960-65076982 CCATGACCACCCTTAGTGCAAGG - Intronic
933175853 2:79172177-79172199 ACATTCCCACCAACAGTATATGG - Intergenic
933577396 2:84085269-84085291 ACAGTCTCACCCAAAGTGGATGG - Intergenic
934354886 2:92485423-92485445 ACATTCCCTTTCATAGAGCAGGG + Intergenic
935062082 2:99617261-99617283 GCATTCCCACCAGGAGTGCATGG + Intronic
935121747 2:100189101-100189123 ACATTCCCACCCATAGTGCAGGG + Intergenic
935521283 2:104108061-104108083 ACAGTCCCACCAACAGTGTAGGG + Intergenic
937661392 2:124433583-124433605 ACAATCCCACCCACAGAACATGG + Intronic
937921853 2:127136754-127136776 CCATTTCCACCCATAGGGGAAGG + Intergenic
938232809 2:129676161-129676183 ACATTCCCACCAGCAGTGTATGG + Intergenic
938367642 2:130747489-130747511 ATCTTCCCACCCACAGTGAAGGG + Intergenic
938535721 2:132242441-132242463 ACATTCCCTTTCATAGAGCAGGG + Intronic
940314491 2:152313226-152313248 ACATTCCCACCAACAATGTATGG + Intergenic
940956225 2:159731141-159731163 ACCTTCCCTCCCAGAGTGCTGGG + Intronic
942266529 2:174232744-174232766 ACATTCCTACCAGCAGTGCACGG - Intronic
943419523 2:187653426-187653448 ACATTCCCACCAATGCAGCAAGG - Intergenic
944973342 2:205019591-205019613 ACATTCCCACCAGCAGTGTATGG + Intronic
946297533 2:218797348-218797370 ACCTTGCCTCCCAAAGTGCAAGG + Intronic
1169199626 20:3702013-3702035 GCCTTCCCACCCAGAGGGCATGG + Intronic
1169334580 20:4745399-4745421 CCAATCCCACCAATAGTGCATGG - Intergenic
1169543192 20:6622995-6623017 ACATACCCACCCATGGAGCCAGG + Intergenic
1171714670 20:28457212-28457234 ACATTCCCTTTCATAGAGCAGGG + Intergenic
1171971304 20:31566855-31566877 ACAGCCCCACCCATACCGCAAGG + Intronic
1174558171 20:51411473-51411495 ACACTACAAACCATAGTGCAAGG + Intronic
1175654536 20:60757906-60757928 ACATTCCCACCAACAGTGGATGG + Intergenic
1178045080 21:28684709-28684731 ACAATCCCACCCATAGTACTTGG + Intergenic
1179267594 21:39818422-39818444 TCTTTCCCTCCCATAGTGAAGGG - Intergenic
1179439272 21:41381764-41381786 ACATTCCCACCAGCAGTGGAGGG - Intronic
1183375439 22:37462126-37462148 ACATGGCCACCCTTACTGCAAGG + Intergenic
1184635868 22:45830744-45830766 ACATTCCCATCAGTAATGCATGG - Intronic
1202722887 2_KI270715v1_random:110018-110040 ACATTCCCTTTCATAGAGCAGGG + Intergenic
950286536 3:11749717-11749739 TCATTCACACCCACAGTGCCTGG + Intergenic
951276369 3:20691372-20691394 ACATTCCCACACACAGTTCTTGG - Intergenic
952332774 3:32379969-32379991 ACATTTCCACCAAGCGTGCAAGG - Intergenic
953722893 3:45371780-45371802 ACATTCCCACCAACAGTGTGAGG - Intergenic
957628307 3:82683785-82683807 ACATTCCCACCAACAGTGCATGG + Intergenic
958668695 3:97174504-97174526 ACATTCCCACACAGTATGCAAGG + Intronic
958842428 3:99223670-99223692 ACATTCCCACCTACAGTGTATGG - Intergenic
959672996 3:109000339-109000361 ACATCTCCACCCCTAGTCCACGG - Intronic
960505684 3:118490496-118490518 ACATTTCCACCAACAGTGTAAGG - Intergenic
960595621 3:119405445-119405467 ACATTCCCACCCATGGGAAAGGG + Intronic
961770549 3:129246609-129246631 ACATTCCCACCAGCAGTGTATGG - Intergenic
961861322 3:129918835-129918857 AGAGTCCCACACATTGTGCATGG + Intergenic
962872450 3:139509467-139509489 AAATTCCCATCAAAAGTGCAGGG - Intergenic
962887773 3:139643248-139643270 ACATTCCCACCAACAATGCACGG - Intronic
963114043 3:141710687-141710709 ACATACCCACCCTTACTCCAAGG + Intergenic
963552151 3:146737537-146737559 ACATTCCTACCAGCAGTGCATGG + Intergenic
963577178 3:147075610-147075632 ACACTCCCACCAACAGTGTAAGG + Intergenic
963645768 3:147912330-147912352 ACATTCCCACCAACAGTCTATGG - Intergenic
963830146 3:149998855-149998877 ACATTCCCACCAACAGTGACTGG - Intronic
964073862 3:152669145-152669167 AAATGCCCACCAATAGTACATGG - Intergenic
964152417 3:153543362-153543384 ACATTCCCACCAACAGTATATGG + Intergenic
964853165 3:161117214-161117236 ACATTCCCACCAACAGTGTATGG - Intronic
964897368 3:161614074-161614096 AAATTTCCAACCATAGTGGAAGG + Intergenic
966193678 3:177293327-177293349 ACTTTCCCACCCCTAATGCCTGG - Intergenic
968009181 3:195261902-195261924 ACATTCCCACCAGCAGTGTATGG - Intronic
968159316 3:196412468-196412490 ATATTCCCATCAAGAGTGCATGG - Intronic
968169686 3:196500038-196500060 ACATTCCCACCAACAGTGCGTGG - Intronic
968429171 4:545123-545145 ACATTCCCACCTGTGCTGCAGGG - Intergenic
968527491 4:1069694-1069716 GCATTCCCACCAATAGAGGATGG + Intronic
968892643 4:3378788-3378810 ACATTCCCACCAACAGTGCAAGG - Intronic
969045642 4:4334654-4334676 CCATTCCCACCAATGGTGCATGG - Intergenic
969066406 4:4485327-4485349 TCAGTCTCACCCATAGGGCAAGG + Intronic
972418663 4:38867405-38867427 ACACTCCCACCGACAGGGCAAGG + Intergenic
974386135 4:61202729-61202751 ACACACCCACCTATAGTGCTGGG - Intronic
975562203 4:75718650-75718672 ACATTCCCACCTCTAAAGCAAGG - Intronic
975641987 4:76510021-76510043 ACAGTCCCACCAATAGTATATGG - Intronic
976642746 4:87356151-87356173 GCACTCCTACCCACAGTGCAGGG - Intronic
976874056 4:89833156-89833178 ACATTCCCACAAAAACTGCAAGG + Intronic
976961019 4:90973545-90973567 ACATTCCCACCAACTGTACAAGG - Intronic
978302732 4:107290065-107290087 AAATTCCCACCAATAATGTATGG + Intergenic
979085039 4:116397424-116397446 CCTCTCCCACCCAAAGTGCAAGG - Intergenic
979679285 4:123442205-123442227 ACATTCCTACTGACAGTGCAAGG + Intergenic
979738135 4:124115157-124115179 ATACTCCCACCTACAGTGCATGG - Intergenic
980597589 4:134974597-134974619 ACATTCCCACCAACAGTGCACGG - Intergenic
980702909 4:136455708-136455730 ACATTCCCACCAAGTGTGCTAGG - Intergenic
980753208 4:137119868-137119890 ACATTTCCACCAACAGTGTATGG - Intergenic
981492667 4:145356756-145356778 ACATTCCCACCAACAGTGTATGG - Intergenic
982990594 4:162268954-162268976 ACATTTCCACCAACAGTGTATGG - Intergenic
983292513 4:165824410-165824432 ACAGTCCCACCAACAGTGTAAGG - Intergenic
983389314 4:167108190-167108212 ACATTCCCACCAACAGTGTACGG - Intronic
983623386 4:169782889-169782911 ACATTACTTCCCATATTGCAAGG + Intergenic
983891502 4:173034588-173034610 ACCTTCCCACCCAGAGGGAATGG - Intronic
983896657 4:173088353-173088375 ACATTCCCACCCAGTGTGTGAGG + Intergenic
983918998 4:173325178-173325200 ACATTCCCAACCATGGTGCAAGG + Intergenic
986399715 5:7369054-7369076 ACATTCCCACCCATTGTCTTGGG + Intergenic
987361836 5:17114206-17114228 TCATTCCCACCCTAAGTGCAGGG - Intronic
987403821 5:17504681-17504703 ACGTTCCCATGAATAGTGCAAGG + Intergenic
987411290 5:17617426-17617448 ACGTTCCCATGAATAGTGCAAGG + Intergenic
987413718 5:17640742-17640764 ACGTTCCCATGAATAGTGCAAGG + Intergenic
987650175 5:20730986-20731008 ACATTCCTCCCCAAAGTACAAGG - Intergenic
988745384 5:34130481-34130503 ACATTCCTCCCCAAAGTACAAGG + Intergenic
991220752 5:64213130-64213152 ACGTTCCCTCCCACAGTGCTTGG + Intronic
992660248 5:78952639-78952661 ACATTCCCATCAAGAATGCATGG - Intronic
993936189 5:94005917-94005939 ACATTCCCACCAGCAGTGTATGG - Intronic
994567264 5:101466067-101466089 TCATTCCCACCAACAGTGTATGG + Intergenic
994974478 5:106784162-106784184 ACATTCCCACCAACAGTGTATGG - Intergenic
996041420 5:118817311-118817333 ACATTCCCACCAACAGTGTATGG - Intergenic
996132830 5:119802716-119802738 ACATTCCCACCAAGTGTTCAAGG + Intergenic
1001929554 5:175663278-175663300 ACATTCCCACCAGCAGTGCACGG + Intronic
1001977817 5:176014575-176014597 ACGTTCCCACCCGTGGTGCCAGG - Intronic
1002070819 5:176678142-176678164 ACATTCACACCCACAATCCAGGG + Intergenic
1003401144 6:5792149-5792171 ACATTCCCACCAACAGTACAAGG + Intergenic
1005383967 6:25267601-25267623 ATATTCCCTCCCCTAGAGCATGG + Intergenic
1005395840 6:25381305-25381327 ACAGACCCACCCAATGTGCAAGG - Intronic
1005543500 6:26838233-26838255 ACATTCCTCCCCAAAGTACAAGG + Intergenic
1006600455 6:35222111-35222133 ACCTTACCACCCATAGGGGAGGG - Intronic
1006651761 6:35557471-35557493 ACATGCCTACCCCTATTGCAAGG + Intergenic
1009014330 6:57880402-57880424 ACATTCCTCCCCAAAGTACAAGG + Intergenic
1009227856 6:61034337-61034359 ATATTACCAACCATAGTGCAGGG + Intergenic
1009636426 6:66270809-66270831 GCATTCCCACCAACAGTGTATGG - Intergenic
1009969220 6:70608985-70609007 CGATTACCACCCATAGTGCGAGG - Intergenic
1010351696 6:74882479-74882501 AATTTCCCACCAATAGAGCATGG + Intergenic
1010948892 6:82011550-82011572 ACATTCCCATCAACAGTACAGGG - Intergenic
1011547387 6:88496119-88496141 ACATTCCCACCCTTAGTGGAAGG - Intergenic
1011749258 6:90438871-90438893 ACCTTACCACCCAAAGTGCTAGG + Intergenic
1011864211 6:91801886-91801908 ACATGGCCTCCCAAAGTGCAGGG + Intergenic
1014399511 6:120970246-120970268 ACATTCCCACCAATAGTACCAGG - Intergenic
1014479182 6:121914211-121914233 ACATTCCCACCAACAGTGTATGG + Intergenic
1016891718 6:149014244-149014266 ACCTTCCCACCCACCTTGCAGGG - Intronic
1017292255 6:152752518-152752540 ACATTCCCAAACATGGTGAAAGG + Intronic
1017710760 6:157165604-157165626 ATATGCCCACCCAAAGTGCTGGG - Intronic
1018086758 6:160307824-160307846 ACATTCCCACCAAATGTGGAAGG + Intergenic
1020334941 7:7056106-7056128 ACATTACTCCCCATAATGCAGGG + Intergenic
1020399031 7:7753880-7753902 ACATTCCCACCAACAGTGTACGG + Intronic
1023528485 7:41129791-41129813 GCATTCCAACACATGGTGCAGGG + Intergenic
1023584274 7:41712857-41712879 ACATTCCAACCAATAGTGTAAGG + Intergenic
1025080791 7:55980738-55980760 TCATTCCCGCGCATTGTGCAGGG - Intronic
1028254919 7:88583098-88583120 AGATTTCCAGCTATAGTGCAAGG - Intergenic
1029054126 7:97722275-97722297 ACATTCCCACTAACAGTGCACGG - Intergenic
1030054876 7:105575224-105575246 GAATTCCCACACATTGTGCAAGG - Intronic
1030547467 7:110914974-110914996 ACATTCCCACCAAGTGTACAAGG - Intronic
1032679531 7:134167647-134167669 ACATTCCCGCCCCTTCTGCAAGG - Intronic
1034822253 7:154226962-154226984 ACATTGCCACCAATAGCACAGGG - Intronic
1038809507 8:30826099-30826121 GCATTCCCACTAAAAGTGCATGG + Intergenic
1040575948 8:48651701-48651723 ATATTCCCACACATAATGCCTGG + Intergenic
1041175693 8:55193916-55193938 ACATTCCCAGCCACTCTGCAAGG - Intronic
1041517037 8:58711739-58711761 ACATTCCCACCAGTAGTGTGTGG - Intergenic
1042046260 8:64655555-64655577 ACACTCCCACCAACAGTGTAAGG - Intronic
1042794970 8:72652078-72652100 ACCTTCCCACCACTAGTCCAAGG + Intronic
1042811510 8:72830568-72830590 ACCCTCCTAACCATAGTGCATGG + Intronic
1043321734 8:78995311-78995333 ACATTCCCACCAACAGTGCATGG - Intergenic
1043340772 8:79235738-79235760 ACATTTCCACCAACAGTGTATGG - Intergenic
1043635084 8:82375188-82375210 ACATTACTACCAATATTGCAGGG + Intergenic
1043852621 8:85232222-85232244 ACATTTCTACCAATAGTGTATGG + Intronic
1045359234 8:101416811-101416833 ACATTCCCACCAACAATGTAGGG - Intergenic
1045824469 8:106380575-106380597 ACATTCCCACCTACAGTGTTTGG + Intronic
1045924363 8:107568617-107568639 ATATTACTACCAATAGTGCAGGG + Intergenic
1045927109 8:107586835-107586857 ACATTCCTCCCAATATTGCAGGG - Intergenic
1046745214 8:117868864-117868886 AAATTCCAGCCCATAGAGCAGGG + Intronic
1049291835 8:141807436-141807458 ACATGTCCACCCATAATGCCAGG + Intergenic
1049834323 8:144724307-144724329 ACAGTCCCACCAACAGTACACGG - Intronic
1051628867 9:19124618-19124640 ACATTCCCACCAACACTGTATGG - Intronic
1052345449 9:27404869-27404891 ACATTCCCACCAACAGTGTATGG + Intronic
1052509340 9:29395084-29395106 ACATTCCCACCAATAATGTAAGG - Intergenic
1052604943 9:30687365-30687387 ATATCCCCACCCATATTTCAGGG - Intergenic
1053144063 9:35700013-35700035 ACACTCCCGGCCATAGTGCAGGG + Exonic
1053320830 9:37097543-37097565 AGATTCCCAGCCACACTGCAAGG - Intergenic
1053591489 9:39518967-39518989 AATTTCCCACCCTTAATGCAAGG + Intergenic
1054042140 9:44960766-44960788 ACATTCCCTTTCATAGAGCAGGG + Intergenic
1054043522 9:44984579-44984601 ACATTCCCTGTCATAGAGCATGG + Intergenic
1054574818 9:66846322-66846344 AATTTCCCACCCTTAATGCAAGG - Intergenic
1056888583 9:90468297-90468319 AAATGCCCTCCAATAGTGCAGGG - Intergenic
1057732830 9:97625513-97625535 ACATTCCCACCAACAGTGACTGG + Intronic
1058520215 9:105808947-105808969 ACATTACTCCCCATATTGCAGGG + Intergenic
1059050693 9:110921770-110921792 ACAAGCCCACCCACATTGCAGGG + Intronic
1059777158 9:117487631-117487653 ACATTCCCAGCCATCGTCCTTGG + Intergenic
1061104951 9:128522825-128522847 ACATTCCCAGTCATAATTCAGGG - Intronic
1061459946 9:130729502-130729524 ACCTTCCCAAACACAGTGCAGGG - Intronic
1061790840 9:133058051-133058073 CCATTGCCACCCACAGTGCCCGG + Exonic
1185535824 X:861017-861039 ACATCCCCACCCACAGTGGATGG + Intergenic
1185881779 X:3747651-3747673 ACATTACCAGCAAGAGTGCATGG - Intergenic
1187702545 X:21977059-21977081 AGATTACCACCCATAGTGCGAGG + Exonic
1189076885 X:37925489-37925511 CCATTCCCACCAACAGTGTATGG + Intronic
1190532292 X:51391603-51391625 ACATTCCCACTAACAGTGTATGG - Intergenic
1190912320 X:54784727-54784749 ACATTCCCACCAACTGTGTATGG - Intronic
1190918941 X:54831814-54831836 ACATTCCCACCAACAGTGTATGG + Intergenic
1190943045 X:55062203-55062225 ACATAGCCACCAACAGTGCAGGG + Intergenic
1192493643 X:71598385-71598407 TCATTCCCACACATAGAGCGGGG - Intronic
1193417642 X:81242922-81242944 ACATTCCCACCAACAGTGTATGG - Intronic
1193585323 X:83314235-83314257 ACATTCCCACCAACAGTGTTTGG - Intergenic
1194332276 X:92598586-92598608 ACATTCCCACAAATAGTGCATGG - Intronic
1194974948 X:100385182-100385204 ATACTCCCACCAATAATGCATGG + Intronic
1195960784 X:110384212-110384234 ACTTTCTCCCCCATAGTGCCTGG + Intronic
1196500003 X:116369563-116369585 ACATTCCCACCAACAGTGCAAGG + Intergenic
1196514857 X:116597702-116597724 ACATTCCCACCAAGTGTACAAGG + Intergenic
1197467378 X:126821186-126821208 ATATTCCCACCCTTAGATCAGGG + Exonic
1197484268 X:127028098-127028120 ACATTCCCACTAACAGTGTATGG - Intergenic
1197826159 X:130592533-130592555 ACATTCTCACCAACAGTGTATGG + Intergenic
1198532514 X:137560230-137560252 ACAGTCCAACCCCTAGTCCAGGG + Intergenic
1198553607 X:137769751-137769773 ACATTACCACCATTAGTGTATGG + Intergenic
1199618026 X:149673862-149673884 ACATTCCCACCAACAGTGTATGG - Intergenic
1199624616 X:149729387-149729409 ACATTCCCACCAACAGTGTATGG + Intergenic
1200640981 Y:5717637-5717659 ACATTCCCACAAATAGTGCATGG - Intronic
1201785126 Y:17767891-17767913 CCATGGCCACCCAAAGTGCAGGG + Intergenic
1201816427 Y:18138096-18138118 CCATGGCCACCCAAAGTGCAGGG - Intergenic
1201917874 Y:19202295-19202317 ACATTACCATCAAGAGTGCATGG + Intergenic
1202084049 Y:21117246-21117268 ATATTCCCACCAAGAGTACAAGG + Intergenic