ID: 1077522346

View in Genome Browser
Species Human (GRCh38)
Location 11:3043765-3043787
Sequence CGCTGATGACTAACAGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 96}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077522336_1077522346 30 Left 1077522336 11:3043712-3043734 CCATCTCTTGGCCTCCCGGCTCT 0: 1
1: 0
2: 1
3: 40
4: 377
Right 1077522346 11:3043765-3043787 CGCTGATGACTAACAGGCCAAGG 0: 1
1: 0
2: 0
3: 9
4: 96
1077522339_1077522346 16 Left 1077522339 11:3043726-3043748 CCCGGCTCTAGCTCAGGCCACAC 0: 1
1: 0
2: 1
3: 25
4: 245
Right 1077522346 11:3043765-3043787 CGCTGATGACTAACAGGCCAAGG 0: 1
1: 0
2: 0
3: 9
4: 96
1077522343_1077522346 -1 Left 1077522343 11:3043743-3043765 CCACACGAGCCAGGACGGCAGAC 0: 1
1: 0
2: 0
3: 3
4: 88
Right 1077522346 11:3043765-3043787 CGCTGATGACTAACAGGCCAAGG 0: 1
1: 0
2: 0
3: 9
4: 96
1077522340_1077522346 15 Left 1077522340 11:3043727-3043749 CCGGCTCTAGCTCAGGCCACACG 0: 1
1: 0
2: 1
3: 9
4: 157
Right 1077522346 11:3043765-3043787 CGCTGATGACTAACAGGCCAAGG 0: 1
1: 0
2: 0
3: 9
4: 96
1077522344_1077522346 -10 Left 1077522344 11:3043752-3043774 CCAGGACGGCAGACGCTGATGAC 0: 1
1: 0
2: 0
3: 1
4: 56
Right 1077522346 11:3043765-3043787 CGCTGATGACTAACAGGCCAAGG 0: 1
1: 0
2: 0
3: 9
4: 96
1077522338_1077522346 19 Left 1077522338 11:3043723-3043745 CCTCCCGGCTCTAGCTCAGGCCA 0: 1
1: 1
2: 2
3: 16
4: 163
Right 1077522346 11:3043765-3043787 CGCTGATGACTAACAGGCCAAGG 0: 1
1: 0
2: 0
3: 9
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077522346 Original CRISPR CGCTGATGACTAACAGGCCA AGG Intronic
903577499 1:24347802-24347824 GGCTGCTGTCTGACAGGCCAGGG + Intronic
904503387 1:30930823-30930845 GGCTAATCACTAACAGGCCCTGG - Intergenic
906740807 1:48181995-48182017 GCCTGATTTCTAACAGGCCATGG + Intergenic
908923190 1:69221306-69221328 CACTGATGACTGACAAGACAGGG + Intergenic
914830935 1:151170424-151170446 ACCTAATGACTAACAGCCCAGGG - Intronic
918877496 1:190067691-190067713 CCCTGATGACTCACAGCCTAAGG - Intergenic
918906291 1:190499904-190499926 GCCTGATTCCTAACAGGCCATGG - Intergenic
920787693 1:209058300-209058322 CCTTAATGACAAACAGGCCAGGG - Intergenic
920904920 1:210154279-210154301 CGCCCATTCCTAACAGGCCATGG - Intronic
922144261 1:222923090-222923112 GCCTGAGGACTAGCAGGCCAAGG + Intronic
1067235628 10:44446195-44446217 GCCTGATTCCTAACAGGCCATGG + Intergenic
1072256918 10:93629886-93629908 TGCTGGTTCCTAACAGGCCATGG + Intronic
1072859714 10:98990529-98990551 GCCTGATTCCTAACAGGCCATGG + Intronic
1073181142 10:101584146-101584168 CTCTGAAGCCTAACAGACCAGGG - Intronic
1077522346 11:3043765-3043787 CGCTGATGACTAACAGGCCAAGG + Intronic
1080761202 11:35250642-35250664 CTCTAATGACTATCAGGCCATGG - Intergenic
1085576132 11:77605434-77605456 GCCTGGTTACTAACAGGCCACGG - Intronic
1091137451 11:133204698-133204720 GGCTGGTGAGTAACAGGCTAGGG + Intronic
1095381644 12:41601493-41601515 GTCTGATTCCTAACAGGCCATGG + Intergenic
1096125537 12:49116726-49116748 GGCTGGTTCCTAACAGGCCATGG - Intergenic
1096431303 12:51545518-51545540 GCCTGATTCCTAACAGGCCACGG + Intergenic
1100567308 12:95809591-95809613 GGCTGGTTCCTAACAGGCCACGG + Intronic
1107645185 13:42487104-42487126 CTTTCATGACTAATAGGCCAGGG + Intergenic
1107714355 13:43184694-43184716 TGGTGATGACTAAGAGGTCAGGG - Intergenic
1109111615 13:58327726-58327748 GGCTGGTTCCTAACAGGCCATGG - Intergenic
1112124865 13:96453964-96453986 CAATGATGACCAACAGGGCAAGG - Intronic
1116286593 14:42980657-42980679 GCCTGGTTACTAACAGGCCATGG + Intergenic
1116898806 14:50342329-50342351 TGCTGTTGTCCAACAGGCCAAGG - Intronic
1117995195 14:61471464-61471486 CGATGATGGCTAACTGGGCATGG - Intronic
1120924363 14:89783010-89783032 GCCTGATTCCTAACAGGCCATGG + Intergenic
1121571333 14:94948817-94948839 CCCTGATGAATATCAGGTCAAGG + Intergenic
1124413467 15:29455684-29455706 GCCTGATTCCTAACAGGCCATGG - Intronic
1127683079 15:61316344-61316366 AGGTCATGGCTAACAGGCCAAGG - Intergenic
1133724056 16:8521074-8521096 TGCTGGTGTCTGACAGGCCAAGG - Intergenic
1135348378 16:21708398-21708420 GGCTGGTTCCTAACAGGCCAGGG + Intronic
1137004893 16:35266702-35266724 TGCTGATGACTCCCAGGCCTGGG + Intergenic
1139275329 16:65722596-65722618 GCCTGATACCTAACAGGCCATGG - Intergenic
1140696883 16:77543475-77543497 AGGTGATGACTCAGAGGCCAGGG + Intergenic
1141281447 16:82633105-82633127 GCCTGATTTCTAACAGGCCATGG + Intronic
1141873990 16:86809031-86809053 CTCCGGTTACTAACAGGCCATGG + Intergenic
1142015085 16:87741320-87741342 ACCTGATTCCTAACAGGCCATGG - Intronic
1145014508 17:19387580-19387602 GGCTGATGAAACACAGGCCAGGG - Intergenic
1146833751 17:36092942-36092964 AGCTGATGACTAGCAGAGCAGGG + Intergenic
1146848340 17:36199783-36199805 AGCTGATGACTAGCAGAGCAGGG + Intronic
1148449602 17:47767721-47767743 GCCTGATTCCTAACAGGCCACGG + Intergenic
1149314684 17:55427897-55427919 GCCTGATCCCTAACAGGCCATGG - Intergenic
1153078963 18:1198009-1198031 AGCTGATTCCTAACAGGCCATGG + Intergenic
1153771908 18:8423370-8423392 CGCTGATGACTCATGGGACAGGG + Intergenic
1160245814 18:77158644-77158666 GCCTGATTTCTAACAGGCCACGG + Intergenic
1165779221 19:38422461-38422483 CGCTGGTTCCTAACAGGCCACGG - Intronic
925838530 2:7968805-7968827 CACTGAGGACTTACAGCCCATGG + Intergenic
927509171 2:23633857-23633879 CGCTGAGGACATGCAGGCCACGG - Intronic
929278659 2:40053737-40053759 CATTTATGACTAACAGGCCAGGG - Intergenic
929764626 2:44833775-44833797 AGATGATGACTAAAAGGACATGG - Intergenic
929889037 2:45904616-45904638 TGATGATTACTAACTGGCCAGGG + Intronic
930046752 2:47179360-47179382 TGGTGATGACCAACATGCCAAGG + Intergenic
942254708 2:174085273-174085295 GCCTGATTCCTAACAGGCCATGG - Intronic
1168909285 20:1433914-1433936 GGCTGGTTCCTAACAGGCCATGG - Intergenic
1171196942 20:23207149-23207171 CGCTGAGGACTGAGAGGCCTTGG + Intergenic
1183475849 22:38035376-38035398 TGCTGAGGCCTAACAGGCCAAGG + Intronic
1183503764 22:38197007-38197029 CGCTGGTTCCTAACAGGCCACGG + Intronic
1185360258 22:50402443-50402465 GGCTGAGAACTTACAGGCCAGGG - Intronic
950073604 3:10171576-10171598 CCCTGATGATTAACAGTACAGGG - Intronic
953211217 3:40876803-40876825 CCCTGATGACAAGCAGGACAAGG - Intergenic
954655520 3:52191819-52191841 CACTGATGCCTACAAGGCCAGGG + Intergenic
954806344 3:53223125-53223147 AGCTGATAACCAACAGGTCAGGG + Intergenic
957837347 3:85613826-85613848 CTCTGAAGTCTGACAGGCCAGGG + Intronic
958958362 3:100485982-100486004 TGGTGATGGCTAACAGACCATGG + Intergenic
959780885 3:110232150-110232172 CACTGGTGGCTCACAGGCCATGG + Intergenic
960583668 3:119301507-119301529 CACAGATGCCTAACAGGCTAAGG - Intronic
961644157 3:128383646-128383668 GGCTGATGCCTTCCAGGCCAGGG - Intronic
974009176 4:56592014-56592036 GCCTGATTCCTAACAGGCCACGG - Intronic
980997944 4:139798992-139799014 CGCTAATCACTTACAGACCAAGG - Intronic
983679958 4:170341972-170341994 ACCTGATTCCTAACAGGCCATGG - Intergenic
984364969 4:178786525-178786547 AGCTGGTTCCTAACAGGCCATGG + Intergenic
986237800 5:5928106-5928128 CGCTGATGATAAAAAGGGCAGGG + Intergenic
989257553 5:39381608-39381630 GGCTGAAGACTGACAGGACAGGG + Exonic
994889927 5:105620499-105620521 ATCTGATGACTAGCAGGCCATGG + Intergenic
995311433 5:110716679-110716701 CTGTGGTTACTAACAGGCCACGG + Intronic
998929536 5:147165684-147165706 GCCTGATTCCTAACAGGCCATGG + Intergenic
1000172702 5:158718691-158718713 CTCTGATGTCTAACAGGCCTGGG - Intronic
1001951929 5:175822342-175822364 CTTTGATGTCTAACAGACCAGGG + Intronic
1007430758 6:41775418-41775440 CGCCGATGTCAGACAGGCCAGGG - Exonic
1013241680 6:108252251-108252273 CCCTGACGAGAAACAGGCCAAGG + Intronic
1015484209 6:133749778-133749800 CCCTGGTTCCTAACAGGCCATGG + Intergenic
1017313447 6:153001766-153001788 CGCTGGTGGCTGACAGGCCAGGG - Intronic
1018176868 6:161184678-161184700 CCCTGATGACTGACTGGGCATGG - Intronic
1019211478 6:170408806-170408828 CGCTGATGACTCAGGGGCAAGGG - Intergenic
1024527185 7:50358656-50358678 TGCTGATCACTCACAAGCCAAGG + Intronic
1026996362 7:74619435-74619457 CGCTGAAGATTCACAGGCCCCGG + Intergenic
1027713437 7:81638489-81638511 CTCTGATGTCTATCAGGTCACGG + Intergenic
1032988806 7:137367644-137367666 GCCTGATTCCTAACAGGCCATGG - Intergenic
1034197095 7:149256371-149256393 GCCTGATTCCTAACAGGCCATGG + Intergenic
1047884255 8:129231126-129231148 GGCTCATGACAAACTGGCCATGG + Intergenic
1048864072 8:138746569-138746591 CTTTGATGACTGAAAGGCCATGG + Intronic
1050575817 9:6994229-6994251 GCCTGTTTACTAACAGGCCACGG + Intronic
1051384022 9:16487291-16487313 CGCTGACACCTAACAGGACATGG + Intronic
1052038071 9:23705800-23705822 CACTGGTTCCTAACAGGCCACGG + Intronic
1052564732 9:30134702-30134724 GCCTGGTTACTAACAGGCCACGG + Intergenic
1057219388 9:93247826-93247848 CCCTGAGCACTCACAGGCCAGGG - Exonic
1057572256 9:96213670-96213692 GCCTGATTCCTAACAGGCCATGG - Intergenic
1058568428 9:106312602-106312624 TCCTGATGACTGATAGGCCAGGG - Intergenic
1188356631 X:29199722-29199744 GCCTGGTTACTAACAGGCCACGG + Intronic
1190068748 X:47261836-47261858 GGCTGGTTCCTAACAGGCCATGG + Intergenic
1194601085 X:95922835-95922857 GCCTGATTCCTAACAGGCCACGG + Intergenic
1195884842 X:109626844-109626866 GGCTGGTTCCTAACAGGCCAAGG - Intronic