ID: 1077522447

View in Genome Browser
Species Human (GRCh38)
Location 11:3044325-3044347
Sequence CCCCAGGAAAACGGGTTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 95}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077522435_1077522447 22 Left 1077522435 11:3044280-3044302 CCTGCTCCCCTAAGGCTGCTATC 0: 1
1: 0
2: 0
3: 9
4: 142
Right 1077522447 11:3044325-3044347 CCCCAGGAAAACGGGTTACCAGG 0: 1
1: 0
2: 0
3: 9
4: 95
1077522442_1077522447 -2 Left 1077522442 11:3044304-3044326 CCACACAGCTGGCGATGGGCTCC 0: 1
1: 0
2: 0
3: 18
4: 151
Right 1077522447 11:3044325-3044347 CCCCAGGAAAACGGGTTACCAGG 0: 1
1: 0
2: 0
3: 9
4: 95
1077522433_1077522447 30 Left 1077522433 11:3044272-3044294 CCAGCATTCCTGCTCCCCTAAGG 0: 1
1: 0
2: 0
3: 13
4: 190
Right 1077522447 11:3044325-3044347 CCCCAGGAAAACGGGTTACCAGG 0: 1
1: 0
2: 0
3: 9
4: 95
1077522438_1077522447 14 Left 1077522438 11:3044288-3044310 CCTAAGGCTGCTATCTCCACACA 0: 1
1: 0
2: 0
3: 20
4: 202
Right 1077522447 11:3044325-3044347 CCCCAGGAAAACGGGTTACCAGG 0: 1
1: 0
2: 0
3: 9
4: 95
1077522437_1077522447 15 Left 1077522437 11:3044287-3044309 CCCTAAGGCTGCTATCTCCACAC 0: 1
1: 0
2: 1
3: 17
4: 103
Right 1077522447 11:3044325-3044347 CCCCAGGAAAACGGGTTACCAGG 0: 1
1: 0
2: 0
3: 9
4: 95
1077522436_1077522447 16 Left 1077522436 11:3044286-3044308 CCCCTAAGGCTGCTATCTCCACA 0: 1
1: 0
2: 0
3: 12
4: 144
Right 1077522447 11:3044325-3044347 CCCCAGGAAAACGGGTTACCAGG 0: 1
1: 0
2: 0
3: 9
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077522447 Original CRISPR CCCCAGGAAAACGGGTTACC AGG Intronic
900519945 1:3100651-3100673 CCCTGGGCAAACGGGTTACATGG - Intronic
901922715 1:12548216-12548238 CCCCAGGAAATAGGGTCAGCAGG - Intergenic
902053526 1:13582504-13582526 CCCCAGGACAAGACGTTACCTGG + Intergenic
904274666 1:29372566-29372588 CCCCAGGAGATCTGATTACCTGG - Intergenic
905315143 1:37077927-37077949 CCCCAGGCAAACATGTTACATGG - Intergenic
908014261 1:59815005-59815027 CCCCAGGAAAGCTCGGTACCAGG - Exonic
909659405 1:78065335-78065357 ACCCAGGAATACGGCTAACCAGG + Intronic
911379861 1:97099789-97099811 CCCCAGGAAAATGAGTTCTCTGG + Intronic
912763466 1:112388463-112388485 TCCCAAGAAAGCGGGTCACCTGG + Intergenic
1070309257 10:75261484-75261506 CCCCAGGAACACGGGCTTCCAGG - Intergenic
1074364949 10:112850233-112850255 CCCCAGGTCAGCGGGTCACCTGG + Intergenic
1077033109 11:479149-479171 ACCCAGAAAAACAGCTTACCTGG - Exonic
1077522447 11:3044325-3044347 CCCCAGGAAAACGGGTTACCAGG + Intronic
1077902057 11:6497565-6497587 CGCCTGAAAAACGGGTTAACAGG - Exonic
1078204348 11:9215062-9215084 ACCCAGGAAAGCTGCTTACCAGG + Intronic
1083000941 11:59290031-59290053 CCCCAGGCAAATGGGAAACCGGG - Intergenic
1090619241 11:128546955-128546977 CCCCAGGAAAACTGTGGACCTGG - Intronic
1091343241 11:134836068-134836090 CCCCATGGAAAGGGGTCACCTGG - Intergenic
1101533796 12:105598961-105598983 CCCAAGGAAAAGGGGTTTCTGGG + Intergenic
1105291579 13:19056824-19056846 CCCCAGGAGAAGGTGTGACCTGG - Intergenic
1113881803 13:113631037-113631059 CCCCAGGGCACAGGGTTACCAGG + Intronic
1114808088 14:25861257-25861279 CACCAGGAAAACGGGTCATATGG + Intergenic
1116867821 14:50045504-50045526 ACCCAGGGAAACGGGTTATCAGG - Intergenic
1118885097 14:69859632-69859654 CCCCGAGAAAACGGGTCTCCAGG + Intronic
1123792397 15:23735042-23735064 TGCCAGGGAGACGGGTTACCAGG - Intergenic
1125499982 15:40233658-40233680 CCTCAGGAAAACGGGTTTTCAGG - Intergenic
1128366266 15:67005669-67005691 CCTGAGGAAAGCTGGTTACCAGG - Intergenic
1129065918 15:72903746-72903768 CTCCAGGGAAAGTGGTTACCAGG - Intergenic
1129732968 15:77942296-77942318 GCCCAGGGAGACGGGTGACCCGG - Intergenic
1131944872 15:97608869-97608891 CCACAGTAGAACAGGTTACCAGG + Intergenic
1138963167 16:62051581-62051603 TCCCAGAAAAATGGGTTGCCAGG + Intergenic
1138980947 16:62267521-62267543 CCCCAGGAATACAGCTAACCAGG + Intergenic
1141092719 16:81141278-81141300 CCCCAGGGAAGTGGATTACCTGG + Intergenic
1141720653 16:85753480-85753502 CCCCAGCACAAAGGGTGACCGGG - Intergenic
1141954906 16:87364258-87364280 CCCCAGGGAAACGTGTCACCAGG + Intronic
1142037772 16:87872539-87872561 TCCCAGGAAAACGACTTACCTGG + Intergenic
1142588127 17:987316-987338 CCCCAGGGAATGGGGTCACCGGG + Intergenic
1142588147 17:987382-987404 CCCCAGGGAATGGGGTCACCAGG + Intergenic
1142588197 17:987543-987565 CCCCAGGGAATGGGGTCACCGGG + Intergenic
1144493041 17:15731261-15731283 ACCCAGCAAAACGGGGTGCCTGG + Intergenic
1144907214 17:18645392-18645414 ACCCAGCAAAACGGGGTGCCTGG - Intronic
1150295773 17:64006612-64006634 CCCCAGGAAACTGGCTTACCTGG + Exonic
1151390947 17:73786319-73786341 CCTAAGGAAAACGGATTTCCTGG - Intergenic
1152463885 17:80455115-80455137 CCCAGGGAAAACGGGCGACCGGG - Intergenic
1156418130 18:36920594-36920616 CCCCAGGATAAAGGTTGACCTGG - Intronic
1156521078 18:37722804-37722826 CCCCAGGAAAGAGGGTGTCCTGG - Intergenic
1158611499 18:58944632-58944654 CCCCAGGGAGACCGGCTACCAGG - Intronic
1161097762 19:2403090-2403112 CCGCAGGAAAAGGAGTTCCCTGG - Exonic
1161708047 19:5831441-5831463 CCCCAGGAAAATGAGGTTCCTGG + Exonic
1162962379 19:14135947-14135969 CCCCATGAAAACGGGTACCTAGG + Intronic
1165118012 19:33540746-33540768 CCCCAGGAAATCAGGACACCTGG - Intergenic
1166561044 19:43732607-43732629 CACCAGGAAAACTGGTGACAAGG + Intronic
925223588 2:2162500-2162522 GCCCAGGAAGAGGGGTGACCTGG - Intronic
926057289 2:9781365-9781387 CGCCAGGAAAATGGGGTTCCCGG + Intergenic
926285897 2:11487915-11487937 GCACAGGAAAACTGGTGACCTGG + Intergenic
926836196 2:17024103-17024125 ACCCAGGAAAACAGCTAACCAGG + Intergenic
933291616 2:80444493-80444515 CCCCAGGAGAAAGGGTTATCTGG - Intronic
939381648 2:141444149-141444171 CCCCAGGAATACAAGTTACAAGG - Intronic
948895870 2:240926575-240926597 CCCCAGGAAGACGGGCCCCCCGG + Intronic
1173626409 20:44476090-44476112 CCCCAGGAAATGGGGACACCTGG + Intronic
1174718482 20:52785697-52785719 CCCCAGGGAAAGGACTTACCTGG - Intergenic
1174765925 20:53254229-53254251 GCCCAGGAAAAGGGCTTTCCAGG + Exonic
1176056828 20:63153199-63153221 TCCCAGGAAAGCGGGTTTCTGGG + Intergenic
1176288976 21:5034245-5034267 GCCCAGGAGAAGGGGTTCCCCGG + Intronic
1176950114 21:15034478-15034500 CCCCAGGAAAACAGTTTTCAGGG - Intronic
1178628173 21:34235976-34235998 CCCCAAGAACACTGGTTGCCAGG + Intergenic
1179868258 21:44229359-44229381 GCCCAGGAGAAGGGGTTCCCCGG - Intronic
1180919822 22:19515962-19515984 CACCAGGAATACTGGTCACCTGG + Intronic
1183697525 22:39431575-39431597 CCGCAGGAAAATGGATTCCCAGG - Exonic
1184426101 22:44410160-44410182 CCCCAGGATAATGGGTTAGCAGG - Intergenic
1184819322 22:46897247-46897269 CCCCAGAAAATCCAGTTACCAGG - Intronic
950416543 3:12872314-12872336 CCCCAGCACAACTGGTTCCCAGG - Intergenic
954507278 3:51089281-51089303 ACCCAGGAAAGCCGCTTACCTGG - Exonic
961074637 3:123970684-123970706 CCCCAGGAAAATGGAGTCCCAGG + Intronic
962381247 3:134899846-134899868 CTCCAGGAAAAGGGCTTTCCAGG + Intronic
970723368 4:19014175-19014197 CCCCAGGTAAACTTGTTATCAGG - Intergenic
971678492 4:29666827-29666849 GCCCAAGAAAATGGGTTACAGGG - Intergenic
982305408 4:153925167-153925189 TCCCAGAAAGACGGGTTAGCAGG - Intergenic
985887229 5:2689005-2689027 TAACAGGAACACGGGTTACCAGG + Intergenic
987159632 5:15128277-15128299 ACCTAGGAATACGGCTTACCAGG - Intergenic
997503512 5:134397423-134397445 CTCCAGGGGAAAGGGTTACCAGG - Intergenic
997826153 5:137108664-137108686 CCCCAGGAAAAGGGTTAAGCAGG + Intronic
999693419 5:154168121-154168143 CCCCGGGGAAACAGGGTACCTGG + Intronic
1002047404 5:176549703-176549725 CCCCAGGGAAACGAGGTAACTGG + Intronic
1002448605 5:179306656-179306678 CCCCAGGAACACGGGTTTTGGGG - Intronic
1004152675 6:13135138-13135160 CCTCAGGAAAACGGTTTAGTGGG - Intronic
1004578669 6:16925692-16925714 CCCCAGGAAATATGGGTACCGGG + Intergenic
1005356837 6:24992493-24992515 ACCTAGGAAAACGGCTGACCAGG + Intronic
1007448816 6:41927580-41927602 CCACAGGAAAACAAGTTCCCTGG + Intronic
1007622559 6:43223904-43223926 CTCCAGGGATACGGGGTACCAGG - Intronic
1008238850 6:49084165-49084187 CCACAGGAAAACAGGGTAACAGG + Intergenic
1020862665 7:13514448-13514470 ACCCAGGAATACAGGTAACCAGG + Intergenic
1025873153 7:65453825-65453847 CCTCAGGAAAAGTGGTTACATGG - Intergenic
1026224667 7:68429748-68429770 CCCCAGGATAACAGGTTCCTGGG + Intergenic
1027271157 7:76519687-76519709 CCCCAGGAAAAGGGGTTCTGGGG + Intergenic
1027320921 7:77009622-77009644 CCCCAGGAAAAGGGGTTCTGGGG + Intergenic
1030549901 7:110945385-110945407 GCCCAGGAAGATGGGTTACCAGG - Intronic
1049193839 8:141304728-141304750 CCCCAGGAAGACGGGACACTTGG - Intronic
1049475801 8:142796431-142796453 TCCCAGGTGGACGGGTTACCTGG - Intergenic
1052517436 9:29501600-29501622 CCCCAGGGAAATGGTTTCCCTGG - Intergenic
1054741360 9:68809386-68809408 TCCCAGCAAAACTGTTTACCAGG + Intronic
1056338771 9:85603324-85603346 CCACAGTAAAACAGGGTACCAGG + Intronic
1057268803 9:93635796-93635818 CCCCAGGAGAAGGTGTGACCTGG + Intronic
1187344093 X:18447201-18447223 CCCCATGACAAAGGATTACCTGG + Intronic
1188368799 X:29343418-29343440 CCCAAGGAAAGGGGGATACCTGG - Intronic