ID: 1077522893

View in Genome Browser
Species Human (GRCh38)
Location 11:3046708-3046730
Sequence GGTTTAGTGCTGTTTTCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 209}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077522893_1077522898 -1 Left 1077522893 11:3046708-3046730 CCACCAGAAAACAGCACTAAACC 0: 1
1: 0
2: 0
3: 12
4: 209
Right 1077522898 11:3046730-3046752 CTGCCCCCACATGAAGGTGGAGG 0: 1
1: 0
2: 3
3: 20
4: 178
1077522893_1077522896 -4 Left 1077522893 11:3046708-3046730 CCACCAGAAAACAGCACTAAACC 0: 1
1: 0
2: 0
3: 12
4: 209
Right 1077522896 11:3046727-3046749 AACCTGCCCCCACATGAAGGTGG 0: 1
1: 0
2: 0
3: 9
4: 143
1077522893_1077522904 20 Left 1077522893 11:3046708-3046730 CCACCAGAAAACAGCACTAAACC 0: 1
1: 0
2: 0
3: 12
4: 209
Right 1077522904 11:3046751-3046773 GGAGTGCCCACAGCCACAGGAGG 0: 1
1: 0
2: 2
3: 26
4: 231
1077522893_1077522908 27 Left 1077522893 11:3046708-3046730 CCACCAGAAAACAGCACTAAACC 0: 1
1: 0
2: 0
3: 12
4: 209
Right 1077522908 11:3046758-3046780 CCACAGCCACAGGAGGAGCTGGG 0: 1
1: 0
2: 10
3: 591
4: 16089
1077522893_1077522895 -7 Left 1077522893 11:3046708-3046730 CCACCAGAAAACAGCACTAAACC 0: 1
1: 0
2: 0
3: 12
4: 209
Right 1077522895 11:3046724-3046746 CTAAACCTGCCCCCACATGAAGG 0: 1
1: 4
2: 89
3: 270
4: 373
1077522893_1077522906 26 Left 1077522893 11:3046708-3046730 CCACCAGAAAACAGCACTAAACC 0: 1
1: 0
2: 0
3: 12
4: 209
Right 1077522906 11:3046757-3046779 CCCACAGCCACAGGAGGAGCTGG 0: 1
1: 1
2: 6
3: 89
4: 1199
1077522893_1077522903 17 Left 1077522893 11:3046708-3046730 CCACCAGAAAACAGCACTAAACC 0: 1
1: 0
2: 0
3: 12
4: 209
Right 1077522903 11:3046748-3046770 GGAGGAGTGCCCACAGCCACAGG 0: 1
1: 0
2: 6
3: 49
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077522893 Original CRISPR GGTTTAGTGCTGTTTTCTGG TGG (reversed) Intronic
902492752 1:16797114-16797136 GGTTTAATACCGTTGTCTGGAGG - Intronic
902829938 1:19005966-19005988 GGTTTGGTGCGGCTTGCTGGGGG - Intergenic
903345838 1:22683821-22683843 GGCTCAGTGCTGTGTGCTGGGGG + Intergenic
903388025 1:22942489-22942511 GGTTCTGGACTGTTTTCTGGTGG - Intergenic
905355392 1:37380311-37380333 GGTCTATTGGAGTTTTCTGGAGG + Intergenic
912610849 1:111042282-111042304 GGATTAGTGCTGTATGCTGGAGG - Intergenic
917059239 1:171018274-171018296 GGGTTGCTGCAGTTTTCTGGGGG - Intronic
917699167 1:177562743-177562765 GGTTAAGTGCTATTTTGGGGAGG + Intergenic
918557805 1:185825326-185825348 GTTTTAGTGCTGTATTTAGGGGG + Intronic
918798328 1:188935912-188935934 GGTGTAGGGCTGTTTTCTTTTGG - Intergenic
920509558 1:206540776-206540798 GTGCTAGTGCTGTTTTCTTGGGG + Intronic
920737634 1:208547980-208548002 TGTTTTGTTCTGTTTTGTGGGGG - Intergenic
921296747 1:213711780-213711802 GGTCTGCTGGTGTTTTCTGGAGG + Intergenic
921918787 1:220642837-220642859 GGTCTGCTGCAGTTTTCTGGGGG - Intronic
922108003 1:222529107-222529129 TGTTTAGAGCTGTTGTGTGGTGG - Intronic
922452089 1:225745650-225745672 GGTTTTCTGTTGTTTTGTGGGGG + Intergenic
922888055 1:229035747-229035769 GGTTTTGCCCTGTTTTCTGATGG + Intergenic
923715006 1:236417590-236417612 GGTTTGGGGCTCTTTTCTGATGG + Intronic
1062875095 10:936722-936744 GGTTTTTTGTTGTTTTTTGGGGG - Intergenic
1063419464 10:5899996-5900018 GGTTTTGTGCTGGTTTGTGCTGG - Intronic
1064944043 10:20768355-20768377 GGTTTTGTGCAGTTGTGTGGAGG - Intergenic
1068371950 10:56128503-56128525 GGTTTGGTGCTATTTTATTGAGG + Intergenic
1072511057 10:96125107-96125129 GGTTTGGTTTTGTTTTTTGGAGG + Intergenic
1072997596 10:100259420-100259442 TTTTTAGTGCTGTTCTTTGGGGG - Intronic
1074523398 10:114244651-114244673 GGTGTAGGGCTGTATTTTGGAGG + Intronic
1074641356 10:115386602-115386624 GCTTAAGTGCTTTTTACTGGAGG - Intronic
1075274957 10:121084962-121084984 GGTGTAGTGGAGTCTTCTGGAGG + Intergenic
1076702691 10:132282361-132282383 GGTTTCCTGCAGTTTTCTGGTGG + Intronic
1077522893 11:3046708-3046730 GGTTTAGTGCTGTTTTCTGGTGG - Intronic
1078447136 11:11412902-11412924 GGTTGAGAGTTGCTTTCTGGGGG - Intronic
1079577900 11:22025818-22025840 GGTTTTTTGGTGTTTGCTGGAGG - Intergenic
1079839792 11:25382544-25382566 GGTTTCTTGATGCTTTCTGGGGG + Intergenic
1081680495 11:44999080-44999102 GGTGTAGTCCTCTTTCCTGGGGG + Intergenic
1085747864 11:79129930-79129952 AGTTTAATGCTGTATTTTGGTGG - Intronic
1086049979 11:82577911-82577933 GGACTCCTGCTGTTTTCTGGGGG - Intergenic
1088034523 11:105296003-105296025 GGTTTGCTGCAGTTTTTTGGAGG + Intergenic
1088337834 11:108728276-108728298 GGTTGAGTGCTCTGTTCTTGAGG + Intronic
1089071727 11:115705515-115705537 TGTTTAGTTTTGTTTTCTTGTGG - Intergenic
1090901969 11:131039976-131039998 GACTTAGGGCTTTTTTCTGGTGG - Intergenic
1092202513 12:6594823-6594845 GGTTAAGCCCTGTTTCCTGGAGG - Intronic
1095931031 12:47625040-47625062 GGTTTGCTGCAGTTTGCTGGAGG - Intergenic
1097452519 12:59753092-59753114 GGTTTAGTGCTTCCTTCAGGAGG - Intronic
1097517056 12:60618626-60618648 GGTCTGCTGCAGTTTTCTGGGGG - Intergenic
1098193533 12:67976335-67976357 GGTCTGGTGCAGTTTTCTGGGGG + Intergenic
1098438685 12:70496485-70496507 GGTTTGCTGCAGTTTGCTGGAGG + Intergenic
1099035315 12:77579995-77580017 GGTTGTGTTCTGTCTTCTGGGGG + Intergenic
1103268613 12:119652732-119652754 GGTTTGGTTTTGTTTTCTGTCGG - Intergenic
1104068632 12:125326520-125326542 GGCTTAATGCTGTTTGATGGGGG + Intronic
1104121701 12:125806128-125806150 GGTTCTGTGCTGTTTTCCTGTGG - Intergenic
1105409166 13:20156762-20156784 GCTTTAGTGCTGATTTCTAGAGG - Intronic
1105668366 13:22586110-22586132 GGGCTGCTGCTGTTTTCTGGGGG + Intergenic
1106429524 13:29666447-29666469 GGTCTACTGGAGTTTTCTGGGGG - Intergenic
1106581749 13:31024809-31024831 TGTTTAGTGCTGGAGTCTGGGGG + Intergenic
1106704007 13:32261209-32261231 TGTTTAGTACTGTTTTCAGAAGG - Intronic
1109807962 13:67469074-67469096 GGTTTGGTGGTGTTTTCTAGTGG + Intergenic
1110103172 13:71634938-71634960 TCTTTATTGCTCTTTTCTGGGGG + Intronic
1110150032 13:72240179-72240201 TGTTTATTGCTGTTTTATGCAGG + Intergenic
1113017942 13:105849750-105849772 GGTAGTGTGCTGTGTTCTGGAGG + Intergenic
1113418038 13:110146214-110146236 GGTTTAGTGCTAGATTCAGGTGG + Intergenic
1115940233 14:38601082-38601104 GGTCTGCTGCTGTTTGCTGGAGG + Intergenic
1116556448 14:46316287-46316309 GTTTTACAGCTGTTTTCTGCAGG + Intergenic
1124080803 15:26493436-26493458 GGTTTATTTATGTTTTCTCGTGG - Intergenic
1124806982 15:32894063-32894085 AGATGAGAGCTGTTTTCTGGTGG - Intronic
1124886446 15:33691638-33691660 AGTTCAGTGTTTTTTTCTGGAGG - Intronic
1125020986 15:34986918-34986940 GGTGCATTGCAGTTTTCTGGAGG - Intronic
1125097244 15:35869083-35869105 GATTTGGTGTTGTTTTCTGAAGG - Intergenic
1128284114 15:66421809-66421831 GGTTTGTTGCTGTTTTTTGTTGG - Intronic
1131298273 15:91171758-91171780 TGTTTTGTGCTGTTTTCTTTTGG + Intronic
1132258092 15:100395676-100395698 TGTTTAGTGGTATTTTATGGTGG + Intergenic
1141716614 16:85730571-85730593 GGTTTAGTTGTGTGGTCTGGGGG - Intronic
1141921652 16:87139573-87139595 GTTTTAGTGGTGCCTTCTGGAGG - Intronic
1143484578 17:7246673-7246695 GGGTTAGAGCAGTTTTCTAGAGG - Intronic
1146072381 17:29694803-29694825 GATTTAGTGCTGTAAACTGGAGG - Intronic
1146666668 17:34709620-34709642 GGTTTAATTCTGTCTTCTGCAGG - Intergenic
1146945637 17:36871259-36871281 GGTTAAGAGCTGGGTTCTGGAGG - Intergenic
1148934505 17:51154070-51154092 GCTTTAGTCCTGTTTTCTCCTGG + Intronic
1150298547 17:64029025-64029047 GGTTAAGTGTTTTATTCTGGAGG + Intergenic
1151576436 17:74954617-74954639 TGTTTAGTGCTGGGTTGTGGCGG - Intronic
1153081484 18:1231461-1231483 GGTCTGCTGCAGTTTTCTGGGGG + Intergenic
1153667810 18:7382047-7382069 GTTTCTGTGCTGTTTTCTGCAGG - Intergenic
1153774200 18:8438422-8438444 CTTTTGGTGCTGATTTCTGGAGG + Intergenic
1153774747 18:8442612-8442634 GGTGTAGGACTGTTTTCTTGTGG + Intergenic
1156354195 18:36327684-36327706 GGTTTATAGCAGTTTTCTTGTGG + Intronic
1156355708 18:36338613-36338635 CCTTAAGGGCTGTTTTCTGGGGG + Intronic
1157944545 18:51964340-51964362 GGTTTAGGTCTGTTTTCCTGAGG - Intergenic
1158445870 18:57519950-57519972 GGTTTAGGTCTGTTTTCCTGGGG - Intergenic
1158824173 18:61195849-61195871 GGTATAGTGCTATATTCTGAGGG - Intergenic
1160097492 18:75888794-75888816 GGTTTTGTGTGGTTTTGTGGGGG + Intergenic
1161005514 19:1933897-1933919 GGTTTTGGGCTGTTTCATGGAGG - Intergenic
1161519884 19:4718009-4718031 GGTCTGGAGCTGTTTGCTGGTGG - Intronic
1168182099 19:54668083-54668105 GGTTCAGTGATGTCTACTGGAGG - Exonic
925367315 2:3319661-3319683 GGTGCAGTGTTGTTTGCTGGAGG - Intronic
929903036 2:46022446-46022468 GGTCTAGTGGTGTTTTCTACAGG + Intronic
930790315 2:55319835-55319857 GTTTTATTTCTGTTTTCTGGAGG - Intronic
931050415 2:58407533-58407555 GGTTTGCTGTTGTTTTTTGGGGG - Intergenic
934527936 2:95063332-95063354 GGTTTTGTGGGGTTTTTTGGGGG + Intergenic
936656327 2:114491886-114491908 CCTTTAGTGCTTTTTCCTGGGGG + Intronic
937162508 2:119778020-119778042 GGTTTAGTGCATTTTTTTAGAGG - Intronic
938183570 2:129207243-129207265 GGTTAAGACCTGCTTTCTGGAGG + Intergenic
938224193 2:129601847-129601869 GGTCTACTGCAGTTTGCTGGAGG + Intergenic
940067157 2:149643111-149643133 GGTCTATTGGAGTTTTCTGGAGG + Intergenic
944233054 2:197415083-197415105 GGTTAAGAGATGTTTTCTGCAGG + Intronic
944478821 2:200134362-200134384 GCTTTATTCCTGTTTTTTGGAGG - Intergenic
945210784 2:207380456-207380478 GGTCTGCTGCAGTTTTCTGGGGG + Intergenic
946059823 2:216932304-216932326 GGTTTACTGCTATTAGCTGGGGG + Intergenic
946388765 2:219402718-219402740 GGGCTAATGCTGTTTTCTGCTGG + Intergenic
946867201 2:224052644-224052666 AGTTTAGTTCTGCCTTCTGGAGG + Intergenic
947033601 2:225825431-225825453 GGTCTGTTGCAGTTTTCTGGAGG - Intergenic
1171097031 20:22342278-22342300 GGTTGGGTGCTGTGTGCTGGTGG - Intergenic
1172838449 20:37887777-37887799 GCTTCAGTGCTGCTTCCTGGAGG - Intergenic
1173071197 20:39768085-39768107 GGTTTTCTGTTGTTTTCAGGAGG + Intergenic
1178425749 21:32477569-32477591 GGTTTGGTGCTGATTGTTGGTGG + Intronic
1182772944 22:32808961-32808983 AGTCTAGTCCTGTCTTCTGGTGG + Intronic
1183406100 22:37631404-37631426 GGTTCAGTTCTGTAATCTGGGGG - Intronic
1184347076 22:43920248-43920270 GTTCTAGTGCTGTTTGCTGTGGG - Intergenic
949169764 3:984690-984712 TGTTTTGTTTTGTTTTCTGGTGG + Intergenic
950597352 3:13996548-13996570 GGTCTGGTGGAGTTTTCTGGAGG + Intronic
950867096 3:16197773-16197795 GTATTACTGCTGTTTTCTGGAGG + Intronic
951330831 3:21365742-21365764 GGTTTGTTGGTGTTTGCTGGAGG - Intergenic
951556297 3:23923950-23923972 AGTTTAGTTGTGTTTTCAGGGGG - Intronic
951680491 3:25289848-25289870 GGTTAAGAACTGTTTACTGGTGG - Intronic
952207729 3:31197371-31197393 GCTTTGTTGCTGTTTTCAGGGGG - Intergenic
953286747 3:41617493-41617515 GGTCTACTGCAGTTTGCTGGAGG - Intronic
954003490 3:47575863-47575885 GGTTGAGGGGTGTTTGCTGGAGG - Intronic
955976203 3:64482666-64482688 GATATAGTGCTGCTTCCTGGGGG + Intergenic
956189708 3:66596966-66596988 GGTTAAGGGCTGTTCTCGGGGGG - Intergenic
957827033 3:85460860-85460882 GCTTTAGTGCTTTTCTCTAGAGG - Intronic
958912170 3:100006150-100006172 GGTATACTGGTGGTTTCTGGGGG + Intronic
959186229 3:103051028-103051050 GCTTTATTGCTGTCCTCTGGAGG + Intergenic
959617736 3:108367078-108367100 GGTCTGCTGCAGTTTTCTGGAGG - Intronic
961443687 3:126967946-126967968 GCTTTAGAGCTGTCTTATGGAGG - Intergenic
961989145 3:131168747-131168769 GGTGAAGTGCTGCTTTCAGGAGG - Intronic
964459241 3:156904342-156904364 GGTTTAGTGTATTTTTCTTGAGG - Intronic
964527586 3:157631513-157631535 TGTAAAGTGCTGTTTACTGGAGG + Intronic
965094852 3:164212249-164212271 GGTTAAGTGATTTTTTCTGATGG - Intergenic
967257547 3:187609184-187609206 GACTCAGTGCTGTTTGCTGGGGG - Intergenic
968758765 4:2430637-2430659 GGCTTAGTACTTTTTTTTGGGGG - Intronic
974331741 4:60488163-60488185 CATTTTGTTCTGTTTTCTGGTGG + Intergenic
975305956 4:72848760-72848782 TGTTTAGTGCTGCCTTCAGGAGG - Intergenic
975322988 4:73029093-73029115 GTATTAGTGCTATTTTCTGATGG + Intergenic
976216243 4:82718222-82718244 GGCTGAGTGCTGTGCTCTGGAGG + Intronic
976393485 4:84530735-84530757 GTTTTTCTGCTGTTTTCTTGTGG - Intergenic
978167712 4:105628654-105628676 GTTTTAGTAGTGCTTTCTGGGGG - Intronic
982412490 4:155094802-155094824 GATCTAGTGCTGTGATCTGGAGG + Intergenic
983071703 4:163275524-163275546 AGTTTAGTCCTGTTAACTGGTGG + Intergenic
983362477 4:166744356-166744378 GGTTTGTTGGAGTTTTCTGGAGG - Intronic
984863989 4:184265507-184265529 TGTTTTGTTTTGTTTTCTGGAGG - Intergenic
986577547 5:9228286-9228308 GGTTTAGTGAGGCTTCCTGGAGG + Intronic
987050905 5:14145281-14145303 GGTTTAGTACTGTCTTCTCTTGG + Intronic
987618312 5:20305245-20305267 GGTTTAGTGGTACCTTCTGGAGG - Intronic
988091860 5:26553001-26553023 GTTTTAGTGCTGTTTCTTAGAGG - Intergenic
990414135 5:55570080-55570102 GGTTTTGTGTTGTTTTCTCCGGG + Intergenic
991209540 5:64088075-64088097 GGTCTAGTGGAGTTTGCTGGAGG - Intergenic
991689409 5:69212073-69212095 GCTCTTGTGTTGTTTTCTGGAGG + Intergenic
992740520 5:79769567-79769589 GGTCTACTGCAGTTTGCTGGAGG + Intronic
993471523 5:88313242-88313264 GGTTTGTTGGAGTTTTCTGGAGG + Intergenic
995099788 5:108285887-108285909 GGTTTACTGGTGTTTTCTTGGGG - Intronic
995480578 5:112588298-112588320 TGTTTAGTGCTTCTTTCAGGAGG - Intergenic
996078522 5:119227478-119227500 GGTTGATTGCTCTTTTCTTGAGG + Intronic
996446624 5:123560782-123560804 GGTAGAATGGTGTTTTCTGGGGG + Intronic
998072573 5:139209748-139209770 TGTTAAGTGTTGCTTTCTGGGGG - Intronic
998252273 5:140561305-140561327 GCTTTGGTGCTGCTTTGTGGGGG - Intronic
1002168900 5:177364379-177364401 GGTTTGGTACTGTGTTTTGGTGG + Intronic
1004899005 6:20177100-20177122 TCTTTAGTGCTGTTTTCTTCAGG - Intronic
1007862233 6:44922993-44923015 GGGTTTTTGCTGTCTTCTGGAGG - Intronic
1008510413 6:52270809-52270831 GTGTTAGTCTTGTTTTCTGGAGG - Intronic
1009740141 6:67733816-67733838 GGTCTACTGCAGTTTGCTGGAGG + Intergenic
1012343371 6:98156414-98156436 GGTCTGCTGCAGTTTTCTGGGGG + Intergenic
1013094317 6:106930410-106930432 TGTTTAGTTTTGTTTTTTGGGGG - Intergenic
1013295673 6:108756326-108756348 AGTTTAGTGCTGCCTTCTGTAGG + Intergenic
1013920376 6:115396188-115396210 GGGTTTCTGCTGTTTGCTGGTGG + Intergenic
1014147312 6:118013016-118013038 ATTTAAGTGCTGTTCTCTGGTGG - Intronic
1015109012 6:129569838-129569860 GGTCTGCTGCTGTTTTCTGGAGG - Intergenic
1015400974 6:132787833-132787855 TATTTAGTGCTATTATCTGGGGG - Intronic
1017384184 6:153863391-153863413 GGTTTGGTGCTTTTCTCTAGTGG - Intergenic
1017480753 6:154852062-154852084 GGTTCAGTCCTGTTTTTTGCGGG + Intronic
1018207414 6:161448454-161448476 GATTTAATGCTGATTTCGGGGGG + Intronic
1018730658 6:166647378-166647400 GGGTTAGTGCAGTTCTCTGCTGG + Intronic
1019227510 6:170525993-170526015 GAATTAGAGCTGTTTTCTAGAGG - Intergenic
1020987165 7:15150372-15150394 GTCTTATTCCTGTTTTCTGGGGG + Intergenic
1021272443 7:18606865-18606887 AGTTTAGTAGTGCTTTCTGGTGG + Intronic
1022055620 7:26730845-26730867 GGTTTACAGCTGTGTTCTGGGGG + Intronic
1022952849 7:35355194-35355216 GGTTATGTGCTGCTTCCTGGTGG + Intergenic
1023711286 7:42995711-42995733 GGTGTGGTGCTATTTTGTGGCGG + Intergenic
1024381338 7:48699900-48699922 GGTTGAGTGCTGTTCCTTGGGGG + Intergenic
1031569307 7:123339216-123339238 GGTTAAGTGATTTTCTCTGGTGG + Intergenic
1032810765 7:135414158-135414180 TGTTTACTGCTGGTTTCTGTAGG - Intronic
1035319852 7:158021804-158021826 GATGTAGTGGTCTTTTCTGGTGG - Intronic
1038554334 8:28495695-28495717 GTTTTTGTCCTTTTTTCTGGAGG - Intronic
1040975194 8:53184321-53184343 GGTTTACTGATGTTTTCTTAAGG + Intergenic
1045143460 8:99313406-99313428 GGTCTATTGGAGTTTTCTGGAGG + Intronic
1046470737 8:114670648-114670670 GGATTATTACTATTTTCTGGGGG + Intergenic
1047121407 8:121908802-121908824 GGTCTACTGCAGTTTGCTGGAGG - Intergenic
1050542195 9:6680380-6680402 TGTTTTGTTCTGTTTTGTGGGGG - Intergenic
1052205249 9:25831109-25831131 GGGTTAGTCTTGCTTTCTGGGGG + Intergenic
1052380837 9:27769005-27769027 AGTATAGTGCTGTTTCCTGGAGG - Intergenic
1055687500 9:78792741-78792763 GCTTTATTGCTGTTTCCTGGTGG + Intergenic
1056486722 9:87066166-87066188 GGCTTAGTGTTGTTTTCCCGAGG - Intergenic
1056577052 9:87863463-87863485 GTTTTTGTCCTTTTTTCTGGAGG + Intergenic
1057882683 9:98805190-98805212 GGTTTATTGCTATTTTTAGGGGG - Intergenic
1059484601 9:114617096-114617118 TTTTTTGTGCTGTTTTCTGAAGG + Exonic
1060034757 9:120245112-120245134 GGTTTTCTGCTGCTTTTTGGTGG + Intergenic
1185747756 X:2585349-2585371 TGTTTAGGGCTGATGTCTGGTGG + Intergenic
1187605299 X:20875477-20875499 GGTCTACTGCAGTTTGCTGGGGG - Intergenic
1188129920 X:26419030-26419052 GGTCTGGTGCAGTTTGCTGGAGG + Intergenic
1189159870 X:38801047-38801069 GGATGACTTCTGTTTTCTGGAGG + Intergenic
1189272235 X:39759702-39759724 GGCTGCGGGCTGTTTTCTGGGGG - Intergenic
1190412189 X:50147768-50147790 GTTTTACTGTTGTTTTTTGGAGG - Intergenic
1190963636 X:55277377-55277399 GGTCTGCTGCAGTTTTCTGGAGG + Intronic
1191683371 X:63864490-63864512 TGTTTAGTGCTTCTTTCAGGAGG + Intergenic
1192286414 X:69742814-69742836 TGTTTGGTTCTGTTTTCTTGGGG + Intronic
1192922644 X:75723863-75723885 GGTTTACTGGAGTTTGCTGGAGG + Intergenic
1193000866 X:76560440-76560462 GGTCTGTTGCTGTTTGCTGGAGG - Intergenic
1193343686 X:80382224-80382246 GGTCTATTGGAGTTTTCTGGAGG + Intronic
1195307230 X:103595712-103595734 GGTGTAGTGGTGTTTTCTTTTGG + Intergenic
1198663575 X:138997053-138997075 GGTCTATTGCAGTTTGCTGGAGG - Intronic
1198830420 X:140744550-140744572 GGATTAGAGCTTTTTTTTGGGGG + Intergenic
1199028539 X:142970004-142970026 GGTTTACTGGTATTTTCTTGAGG - Intergenic
1199609349 X:149599809-149599831 GGTTTCCTGCCTTTTTCTGGCGG - Intronic
1199629768 X:149769545-149769567 GGTTTCCTGCCTTTTTCTGGCGG + Intergenic
1201283037 Y:12357534-12357556 GGATTAGTTTTATTTTCTGGTGG + Intergenic
1201946479 Y:19515664-19515686 GGTCTACTGCAGTTTGCTGGAGG - Intergenic