ID: 1077522894

View in Genome Browser
Species Human (GRCh38)
Location 11:3046711-3046733
Sequence GCAGGTTTAGTGCTGTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 448
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 430}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077522894_1077522895 -10 Left 1077522894 11:3046711-3046733 CCAGAAAACAGCACTAAACCTGC 0: 1
1: 0
2: 0
3: 17
4: 430
Right 1077522895 11:3046724-3046746 CTAAACCTGCCCCCACATGAAGG 0: 1
1: 4
2: 89
3: 270
4: 373
1077522894_1077522896 -7 Left 1077522894 11:3046711-3046733 CCAGAAAACAGCACTAAACCTGC 0: 1
1: 0
2: 0
3: 17
4: 430
Right 1077522896 11:3046727-3046749 AACCTGCCCCCACATGAAGGTGG 0: 1
1: 0
2: 0
3: 9
4: 143
1077522894_1077522908 24 Left 1077522894 11:3046711-3046733 CCAGAAAACAGCACTAAACCTGC 0: 1
1: 0
2: 0
3: 17
4: 430
Right 1077522908 11:3046758-3046780 CCACAGCCACAGGAGGAGCTGGG 0: 1
1: 0
2: 10
3: 591
4: 16089
1077522894_1077522904 17 Left 1077522894 11:3046711-3046733 CCAGAAAACAGCACTAAACCTGC 0: 1
1: 0
2: 0
3: 17
4: 430
Right 1077522904 11:3046751-3046773 GGAGTGCCCACAGCCACAGGAGG 0: 1
1: 0
2: 2
3: 26
4: 231
1077522894_1077522906 23 Left 1077522894 11:3046711-3046733 CCAGAAAACAGCACTAAACCTGC 0: 1
1: 0
2: 0
3: 17
4: 430
Right 1077522906 11:3046757-3046779 CCCACAGCCACAGGAGGAGCTGG 0: 1
1: 1
2: 6
3: 89
4: 1199
1077522894_1077522903 14 Left 1077522894 11:3046711-3046733 CCAGAAAACAGCACTAAACCTGC 0: 1
1: 0
2: 0
3: 17
4: 430
Right 1077522903 11:3046748-3046770 GGAGGAGTGCCCACAGCCACAGG 0: 1
1: 0
2: 6
3: 49
4: 343
1077522894_1077522898 -4 Left 1077522894 11:3046711-3046733 CCAGAAAACAGCACTAAACCTGC 0: 1
1: 0
2: 0
3: 17
4: 430
Right 1077522898 11:3046730-3046752 CTGCCCCCACATGAAGGTGGAGG 0: 1
1: 0
2: 3
3: 20
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077522894 Original CRISPR GCAGGTTTAGTGCTGTTTTC TGG (reversed) Intronic
901154134 1:7124061-7124083 GCAGCTATAGTGGTGTTTCCAGG + Intronic
901908064 1:12431852-12431874 GCAGGTCTTGTTCTGCTTTCAGG - Intronic
905355391 1:37380308-37380330 GCAGGTCTATTGGAGTTTTCTGG + Intergenic
905469137 1:38178660-38178682 ACAGATTTAATGCAGTTTTCTGG + Intergenic
906908131 1:49917075-49917097 GCATGTTTAGTGCTTCTTTCAGG - Intronic
906925842 1:50115579-50115601 GGAAGTTTAGTTCTTTTTTCAGG + Intronic
907679396 1:56549760-56549782 GCAGATTTTGGGGTGTTTTCTGG - Intronic
908169506 1:61490820-61490842 CCAGGTTTTCTGCTGTGTTCTGG - Intergenic
909449194 1:75779584-75779606 CCATGTTTAGTGCTTTCTTCAGG - Intronic
909454102 1:75830779-75830801 CCATGTTTAGTGCTTTCTTCAGG - Intronic
910086566 1:83410346-83410368 GCAATTTTAGTACTGTTTTATGG + Intergenic
911990854 1:104694864-104694886 GCATGTTTAGTGCTTCCTTCAGG - Intergenic
912535991 1:110371535-110371557 GCAGGTTTACTTCTGTTAACAGG + Intronic
912613862 1:111077669-111077691 CCATGTTTAGTGCTTTCTTCAGG + Intergenic
914683276 1:149956186-149956208 CCATGTTTAGTGCTTCTTTCAGG + Intronic
914688581 1:150004746-150004768 TCAGGTATAGTCCTGTTTCCAGG + Intronic
915988661 1:160491186-160491208 GCAGGTGTAGTCCTGTTCACTGG + Exonic
918945671 1:191061443-191061465 CCAGGTTTAGTGCTTCCTTCAGG + Intergenic
919506663 1:198407542-198407564 CAAGGTTTAGTGCTGTTTCTAGG - Intergenic
919568267 1:199216721-199216743 CCATATTTAGTGCTTTTTTCAGG + Intergenic
920923350 1:210317517-210317539 GCAGTATCTGTGCTGTTTTCGGG + Intergenic
921296746 1:213711777-213711799 GCAGGTCTGCTGGTGTTTTCTGG + Intergenic
921534369 1:216327636-216327658 GCAGGTTTAGAGCAGTTTGTCGG - Exonic
921547304 1:216487494-216487516 GCACGTTTAGTGCTTCCTTCAGG - Intergenic
921918790 1:220642840-220642862 GCAGGTCTGCTGCAGTTTTCTGG - Intronic
922610836 1:226926185-226926207 GCATGTTTAGTGCTTCCTTCAGG + Intronic
923867929 1:237960517-237960539 GCAGGGCTACTGCTGTTTGCTGG - Intergenic
924521993 1:244813583-244813605 TCAGGTTTATTGCTGATTACTGG + Intergenic
924634160 1:245769006-245769028 GCAGGTTAAGTTCTCCTTTCAGG - Intronic
1063656830 10:7998965-7998987 GAAGGCTTTGTTCTGTTTTCCGG - Intronic
1064792264 10:18971230-18971252 CCAGGTTTAGTGCTTCCTTCAGG - Intergenic
1064916410 10:20463829-20463851 CCATGTTTAGTGCTTCTTTCAGG + Intergenic
1065055118 10:21836316-21836338 CCATGTTTAGTGCTGCCTTCAGG - Intronic
1065119173 10:22512381-22512403 CCATGTTTAGTGCTTCTTTCAGG + Intergenic
1066655412 10:37694813-37694835 GCATGTTTAGTGCTTCCTTCAGG - Intergenic
1066709536 10:38218245-38218267 CCATGTTTAGTGCTTCTTTCAGG - Intergenic
1066755403 10:38706831-38706853 GCATGTTTAGTGCTTCCTTCAGG - Intergenic
1068518050 10:58048296-58048318 GCAGGCTTAGTATTGTTTCCTGG - Intergenic
1068646391 10:59472335-59472357 CCATGTTTAGTGCTTCTTTCAGG - Intergenic
1069188829 10:65462577-65462599 CCATGTTTAGTGCTTCTTTCAGG + Intergenic
1069264084 10:66436839-66436861 CCATGTTTAGTGCTTTCTTCAGG + Intronic
1070061887 10:72991533-72991555 CCATGTTTAGTGCTTTCTTCAGG - Intergenic
1070343460 10:75519831-75519853 CCAGGTTTAGTGCTTCCTTCAGG + Intronic
1071441675 10:85703882-85703904 CCATGTTTAGTGCTTCTTTCAGG + Intronic
1072854626 10:98934427-98934449 CCATGTTTAGTGCTTCTTTCAGG + Intronic
1072929021 10:99644706-99644728 CCATGTTTAGTGCTGCCTTCAGG + Intergenic
1074241041 10:111639082-111639104 CCATGTTTAGTGCTTCTTTCAGG - Intergenic
1074708100 10:116153493-116153515 ACAGGTTGAGTGCTGTCTGCTGG + Intronic
1077433831 11:2528800-2528822 GCTGGTTTCATGCTGCTTTCTGG + Intronic
1077522894 11:3046711-3046733 GCAGGTTTAGTGCTGTTTTCTGG - Intronic
1077776313 11:5275811-5275833 GCTGGTTTAGTCATGTTTTCTGG + Intronic
1077853024 11:6093735-6093757 CCATATTTAGTGCTTTTTTCAGG + Intergenic
1078165532 11:8880545-8880567 GCAGCTTTAGTGCTGTTTATTGG - Intronic
1078321798 11:10341602-10341624 CCATGTTTAGTGCTTCTTTCAGG - Intronic
1078336566 11:10468007-10468029 CCAGGTTTAGTGCTTCCTTCAGG - Intronic
1078560599 11:12367933-12367955 GCATGTTTAGTGCTTCCTTCAGG - Intergenic
1078732691 11:13990723-13990745 CCATGTTTAGTGCTTCTTTCAGG + Intronic
1079276481 11:19041962-19041984 GCATGTTTAGTGCTTCCTTCAGG - Intergenic
1079577901 11:22025821-22025843 GCAGGTTTTTTGGTGTTTGCTGG - Intergenic
1079743195 11:24090721-24090743 GCTGGTATAGTACTCTTTTCTGG + Intergenic
1080811117 11:35704751-35704773 GCATGTTTAGTGCTTCCTTCAGG - Intronic
1081405231 11:42689994-42690016 CCATGTTTAGTGCTGCCTTCAGG - Intergenic
1082135612 11:48546055-48546077 CCATGTTTAGTGCTGCCTTCAGG + Intergenic
1082634439 11:55579139-55579161 CCATGTTTAGTGCTTTCTTCAGG - Intergenic
1083003487 11:59319619-59319641 CCATGTTTAGTGCTTCTTTCAGG + Intergenic
1085798117 11:79562483-79562505 GGAGGTTTAGTTTAGTTTTCTGG - Intergenic
1085820815 11:79791420-79791442 GCATGTTTAGTGCTTCCTTCAGG - Intergenic
1085884631 11:80507093-80507115 CCATGTTTAGTGCTTTCTTCAGG - Intergenic
1086024932 11:82279314-82279336 CCATGTTTAGTGCTTCTTTCAGG - Intergenic
1086414408 11:86574495-86574517 GCAGGTCTACTGCAGTTTGCTGG + Intronic
1086883038 11:92171403-92171425 CCATGTTTAGTGCTTCTTTCAGG - Intergenic
1088034522 11:105296000-105296022 GCAGGTTTGCTGCAGTTTTTTGG + Intergenic
1090567312 11:128008462-128008484 CCATGTTTAGTGCTTTCTTCAGG - Intergenic
1091417325 12:299537-299559 CCATGTTTAGTGCTTTCTTCAGG - Intronic
1091775633 12:3182960-3182982 GCAGGTTGAGAGCTGTCTCCGGG + Intronic
1093342953 12:18000554-18000576 GTAGGTCTAGTGCTGATTTCTGG - Intergenic
1093404447 12:18787195-18787217 GCATGTTTAGTGCTTCCTTCAGG - Intergenic
1093804755 12:23418259-23418281 CCATGTTTAGTGCTTCTTTCAGG - Intergenic
1094263070 12:28523726-28523748 CCAGGTTTAGTGCTTCCTTCAGG + Intronic
1094265335 12:28552468-28552490 GTAGGTTTAATGCTGTTCTATGG - Intronic
1095059383 12:37664741-37664763 CCATGTTTAGTGCTTCTTTCAGG + Intergenic
1095639648 12:44473138-44473160 CCATGTTTAGTGCTTCTTTCAGG + Intergenic
1095720399 12:45393835-45393857 CCATGTTTAGTGCTTGTTTCAGG - Intronic
1095845444 12:46738965-46738987 CCATGTTTAGTGCTTTCTTCAGG - Intergenic
1095931032 12:47625043-47625065 GCAGGTTTGCTGCAGTTTGCTGG - Intergenic
1096673430 12:53213719-53213741 GGAGGGTTAGTGCTGTTTCTGGG + Intronic
1096963104 12:55600043-55600065 CCATGTTTAGTGCTTTCTTCAGG - Intergenic
1097452520 12:59753095-59753117 CCAGGTTTAGTGCTTCCTTCAGG - Intronic
1097517059 12:60618629-60618651 GCAGGTCTGCTGCAGTTTTCTGG - Intergenic
1098193530 12:67976332-67976354 GCGGGTCTGGTGCAGTTTTCTGG + Intergenic
1098438571 12:70495373-70495395 GCATGTTTAGTGCTTCCTTCAGG + Intergenic
1098438684 12:70496482-70496504 GCAGGTTTGCTGCAGTTTGCTGG + Intergenic
1100463618 12:94824774-94824796 CCATGTTTAGTGCTTTCTTCAGG - Intergenic
1100900981 12:99239907-99239929 CCATGTTTAGTGCTTTCTTCAGG - Intronic
1101066744 12:101029171-101029193 GCATATTTAGTGCTTCTTTCAGG - Intronic
1101957505 12:109223920-109223942 GCATGGTCAGTGCTGTTCTCTGG - Intronic
1101980031 12:109397934-109397956 CCAGGGTTAGTGCTGGTTTTAGG + Intronic
1104243147 12:127011053-127011075 GCTGGTAAAGTGCTGTTTCCTGG + Intergenic
1104871810 12:132004712-132004734 GCAAGTACAGTGCTGTTTCCTGG + Intronic
1106429527 13:29666450-29666472 GCAGGTCTACTGGAGTTTTCTGG - Intergenic
1106980396 13:35272345-35272367 CCAAGTTTAGTGCTTCTTTCAGG - Intronic
1107791024 13:44002348-44002370 TCAGGATTGGTGCTGTTATCTGG + Intergenic
1108160618 13:47634314-47634336 CCATATTTAGTGCTGCTTTCAGG - Intergenic
1108406761 13:50111221-50111243 GCAGTTTTATTGCATTTTTCTGG + Intronic
1109986285 13:69990167-69990189 CCATCTTTAGTGCTGCTTTCAGG - Intronic
1110135703 13:72064257-72064279 CCATGTTTAGTGCTTCTTTCAGG - Intergenic
1110890388 13:80690518-80690540 GCAGGTCTACTGCAGTTTACTGG - Intergenic
1113199410 13:107849627-107849649 GCAGTTTTCATGCTGTTTACTGG - Intronic
1113583348 13:111444898-111444920 TCACGTTTTGTGTTGTTTTCGGG - Intergenic
1113603153 13:111585612-111585634 GCAGGTGCTGTGCTGTTTTCTGG + Intergenic
1113877690 13:113604865-113604887 GCACGTTTACTGCTGTGTGCAGG + Intronic
1115940232 14:38601079-38601101 GCAGGTCTGCTGCTGTTTGCTGG + Intergenic
1116489000 14:45484784-45484806 ACATGTTTAGTGCTTCTTTCAGG + Intergenic
1117042750 14:51781709-51781731 GTTGATTTAGTGCTTTTTTCAGG + Intergenic
1117089869 14:52238895-52238917 TCAGGTTCAGTGCTGTTTAATGG - Intergenic
1117299033 14:54405989-54406011 CCAGGTTTAGTGCTTCCTTCAGG + Intronic
1117350082 14:54872337-54872359 CCATGTTTAGTGCTTCTTTCAGG - Intronic
1117358628 14:54949983-54950005 CCATGTTTAGTGCTTCTTTCAGG - Intronic
1117529123 14:56641505-56641527 CCATGTTTAGTGCTTCTTTCAGG - Intronic
1117891355 14:60425647-60425669 CCATGTTTAGTGCTTTCTTCAGG + Intronic
1120675551 14:87417707-87417729 CCAGGTTTAGTGCTTCCTTCAGG + Intergenic
1123508569 15:20971963-20971985 GTAGGTCTAGAGGTGTTTTCTGG + Intergenic
1124032062 15:26020757-26020779 GCAGGTTGTGGGCTGTTTTCTGG + Intergenic
1124881649 15:33648589-33648611 GGAAGTCTAGTGCTTTTTTCTGG - Intronic
1125351986 15:38777739-38777761 CCATGTTTAGTGCTTTCTTCAGG + Intergenic
1125837562 15:42766109-42766131 CCATGTTTAGTGCTTCTTTCAGG - Intronic
1127158241 15:56151549-56151571 CCATGTTTAGTGCTTCTTTCAGG - Intronic
1127339731 15:58028390-58028412 CCATGTTTAGTGCTTCTTTCAGG - Intronic
1130572097 15:85055960-85055982 CCATGTTTAGTGCTTTTTTCAGG + Intronic
1133956733 16:10450966-10450988 CCATGTTTAGTGCTTCTTTCAGG + Intronic
1136731285 16:32415936-32415958 CCATGTTTAGTGCTTCTTTCAGG + Intergenic
1137051734 16:35719976-35719998 CCATGTTTAGTGCTTCTTTCAGG + Intergenic
1137083572 16:36096075-36096097 CCAGGTTTAGTGCTTCCTTCAGG + Intergenic
1140883609 16:79222327-79222349 CCATGTTTAGTGCTTTCTTCAGG - Intergenic
1140909088 16:79435634-79435656 GCAGTTTTAGTCCTCTTCTCAGG + Intergenic
1146232739 17:31128473-31128495 CCATATTTAGTGCTGCTTTCAGG + Intronic
1146862385 17:36314813-36314835 GCCGGCTCAGTGCTGTTTTTGGG + Intronic
1147092713 17:38118912-38118934 GCCGGCTCAGTGCTGTTTTTGGG + Intergenic
1147104495 17:38201579-38201601 GCCGGCTCAGTGCTGTTTTTGGG - Intergenic
1147902306 17:43796635-43796657 CCAGGTTTAGTGCTTCCTTCAGG + Intergenic
1148424997 17:47586850-47586872 GCCGGCTCAGTGCTGTTTTTGGG + Intronic
1153081481 18:1231458-1231480 GCAGGTCTGCTGCAGTTTTCTGG + Intergenic
1153941307 18:9980749-9980771 CCATGTTTAGTGCTCTCTTCAGG + Intergenic
1154320487 18:13347223-13347245 CCATGTTTAGTGCTTTCTTCAGG + Intronic
1157029567 18:43889421-43889443 GCAGTTTCAATGCTGGTTTCTGG + Intergenic
1157061954 18:44301842-44301864 CCATGTTTAGTGCTTTTTTGAGG - Intergenic
1157893965 18:51446830-51446852 GCAGGTGCAGTGCTGTGTTTTGG + Intergenic
1159387468 18:67743988-67744010 CCATGTTTAGTGCTTCTTTCAGG - Intergenic
1163995842 19:21046490-21046512 CCATGTTTAGTGCTTCTTTCAGG + Intronic
1164351319 19:27347010-27347032 CCATGTTTAGTGCTTCTTTCAGG + Intergenic
1164406055 19:27947825-27947847 CCATGTTTAGTGCTTTCTTCAGG + Intergenic
1164495711 19:28758831-28758853 GCATGTTTAGTGCTTCCTTCAGG - Intergenic
1164688062 19:30183989-30184011 GCAGTTTTAGCACTGTGTTCTGG + Intergenic
1168484918 19:56753142-56753164 GAAAGTATAGAGCTGTTTTCTGG + Intergenic
1168484919 19:56753169-56753191 GAAAGTATAGAGCTGTTTTCTGG + Intergenic
925334485 2:3084353-3084375 CCATGTTTAGTGCTTCTTTCAGG - Intergenic
925367316 2:3319664-3319686 GCAGGTGCAGTGTTGTTTGCTGG - Intronic
925367457 2:3320266-3320288 GCAGGTATAGTGTTGTCTGCAGG - Intronic
925835761 2:7945148-7945170 GCAGTTTTCCTGCTGTTTTGGGG + Intergenic
926970433 2:18462365-18462387 CCATGTTTAGTGCTTTCTTCAGG + Intergenic
927657511 2:24962850-24962872 GGAGGTTTTTTGCTCTTTTCTGG - Intronic
928447301 2:31344761-31344783 GCAGGTGAAGTGAGGTTTTCAGG + Intronic
932660339 2:73646356-73646378 CCAGGTTTAGTGCTTCCTTCAGG + Intergenic
932991859 2:76797455-76797477 CCATGTTTAGTGCTTTCTTCAGG - Intronic
933018699 2:77163799-77163821 CCATGTTTAGTGCTTTCTTCAGG - Intronic
933129698 2:78656811-78656833 CCATGTTTAGTGCTTTCTTCAGG - Intergenic
934831259 2:97527394-97527416 CCATGTTTAGTGCTTTCTTCAGG - Intronic
934877456 2:97938017-97938039 CCATGTTTAGTGCTTCTTTCAGG - Intronic
935173567 2:100629088-100629110 GCAGTTTTGGTGATGTTTCCAGG + Intergenic
936995713 2:118411572-118411594 CCATGTTTAGTGCTTCTTTCAGG - Intergenic
937063871 2:119002485-119002507 GCATGTTTAGTGCTTCCTTCAGG + Intergenic
937464820 2:122123301-122123323 CCATGTTTAGTGCTTCTTTCAGG + Intergenic
938071095 2:128308776-128308798 GCAGGTTGGGTCCTGTTATCTGG - Intronic
938224192 2:129601844-129601866 GCAGGTCTACTGCAGTTTGCTGG + Intergenic
939072175 2:137556532-137556554 CCATGTTTAGTGCTTTCTTCAGG - Intronic
939152516 2:138489914-138489936 GCAGGTTGAGAGCAGTTCTCAGG + Intergenic
939644574 2:144681572-144681594 GCAAGTCTAGTCCTGTTTTCAGG + Intergenic
940067156 2:149643108-149643130 GCAGGTCTATTGGAGTTTTCTGG + Intergenic
940456756 2:153911559-153911581 CCATATTTAGTGCTTTTTTCAGG + Intronic
940465664 2:154023846-154023868 CCATGTTTAGTGCTTCTTTCAGG + Intronic
942405428 2:175648637-175648659 CCATGTTTAGTGCTTCTTTCAGG - Intergenic
942650208 2:178158468-178158490 GCAGGATTAGTGCCTTTTTAAGG - Intergenic
943233907 2:185292920-185292942 GCATGTTTAGTGCTTCCTTCAGG - Intergenic
943309425 2:186308290-186308312 GCAGGATTACTTCTGTTTGCAGG + Intergenic
943583708 2:189713603-189713625 GCATGTTTAGTGCTTTCTTCAGG - Intronic
945164524 2:206928383-206928405 CCATGTTTAGTGCTTCTTTCAGG - Intergenic
948756374 2:240161879-240161901 GCAGGGTGGATGCTGTTTTCTGG - Intergenic
1170532470 20:17308426-17308448 GCATGTTTAGTTCTTTTTTGGGG - Intronic
1170995860 20:21357822-21357844 GCAAGTTCAGAGCTGTGTTCTGG - Intronic
1171443338 20:25184984-25185006 CCATGTTTAGTGCTTCTTTCAGG + Intergenic
1173071196 20:39768082-39768104 GTAGGTTTTCTGTTGTTTTCAGG + Intergenic
1173786312 20:45795350-45795372 GCACGTTCAGTGCTGCCTTCTGG - Exonic
1174443123 20:50571874-50571896 GCAGCTTTAGTGAGGATTTCAGG - Intronic
1176344332 21:5728177-5728199 GCAGGTCCAGTGCAGTTTGCTGG + Intergenic
1176351146 21:5848761-5848783 GCAGGTCCAGTGCAGTTTGCTGG + Intergenic
1176500495 21:7596279-7596301 GCAGGTCCAGTGCAGTTTGCTGG - Intergenic
1176538653 21:8126246-8126268 GCAGGTCCAGTGCAGTTTGCTGG + Intergenic
1177735785 21:25086910-25086932 GCTGGTTTAGTCCTTTTGTCTGG - Intergenic
1177763968 21:25435447-25435469 CCATATTTAGTGCTTTTTTCAGG - Intergenic
1177810534 21:25920217-25920239 GCATGTTTAGTGCTTCCTTCAGG - Intronic
1181665675 22:24394721-24394743 GAACGTGTAGTGCTGTTTCCTGG + Intronic
1182993466 22:34790675-34790697 CCATGTTTAGTGCTTTCTTCAGG - Intergenic
1184196290 22:42931309-42931331 GCAGTGTTAGTTTTGTTTTCTGG - Intronic
1184957921 22:47904510-47904532 GCAAGTCAATTGCTGTTTTCAGG - Intergenic
1203243601 22_KI270733v1_random:42601-42623 GCAGGTCCAGTGCAGTTTGCTGG + Intergenic
949287864 3:2428223-2428245 CCATGTTTAGTGCTTTCTTCAGG + Intronic
950619494 3:14192928-14192950 CCATGTTTAGTGCTTCTTTCAGG + Intronic
950867095 3:16197770-16197792 TCAGTATTACTGCTGTTTTCTGG + Intronic
951155803 3:19351726-19351748 CCATGTTTAGTGCTTTCTTCAGG - Intronic
951330832 3:21365745-21365767 GCAGGTTTGTTGGTGTTTGCTGG - Intergenic
953286748 3:41617496-41617518 GCAGGTCTACTGCAGTTTGCTGG - Intronic
954235637 3:49255157-49255179 GAAGCTTTTGTGCTGTTGTCTGG + Intronic
954828130 3:53393119-53393141 CCATGTTTAGTGCTTCTTTCAGG - Intergenic
954931558 3:54286917-54286939 CCATGTTTAGTGCTTCTTTCAGG - Intronic
955117932 3:56024449-56024471 GCAGGGCTAGTGGTGTTGTCCGG - Intronic
955469786 3:59274528-59274550 TCAGGTATTGTGTTGTTTTCTGG + Intergenic
955477960 3:59358953-59358975 CCATGTTTAGTGCTTTCTTCAGG + Intergenic
956207212 3:66767814-66767836 CCATGTTTAGTGCTTCTTTCAGG + Intergenic
956394652 3:68812164-68812186 CCATGTTTAGTGCTTCTTTCAGG - Intronic
957780625 3:84813923-84813945 CCATGTTTAGTGCTTTCTTCAGG + Intergenic
958167955 3:89901376-89901398 CCATGTTTAGTGCTTTCTTCAGG - Intergenic
958412454 3:93834233-93834255 CCATGTTTAGTGCTTTCTTCAGG - Intergenic
958694367 3:97509337-97509359 GCATGTTTAGTGCTTCCTTCAGG + Intronic
959071797 3:101708595-101708617 ACAGTTTTAGTGGTGTTTTACGG - Intergenic
959617737 3:108367081-108367103 GCAGGTCTGCTGCAGTTTTCTGG - Intronic
959618194 3:108371316-108371338 CCATGTTTAGTGCTTTCTTCAGG - Intronic
959955876 3:112237608-112237630 CCAGGTTTAGTGCTTCCTTCAGG + Intronic
960377938 3:116926474-116926496 CCATGTTTAGTGCTTCTTTCAGG + Intronic
962831516 3:139146332-139146354 CCACGTTTAGTGCTTCTTTCAGG + Intronic
962832037 3:139151564-139151586 CCATGTTTAGTGCTCCTTTCAGG - Intronic
963303350 3:143622605-143622627 CCATGTTTAGTGCTTCTTTCAGG - Intronic
963339998 3:144022148-144022170 CCATGTTTAGTGCTTTCTTCAGG + Intronic
963532207 3:146484780-146484802 TCATATTTAGTGCTTTTTTCAGG - Intronic
964500408 3:157342015-157342037 CCAGGTTTAGTGCTTCCTTCAGG - Intronic
965194314 3:165574179-165574201 CCATGTTTAGTGCTTCTTTCAGG - Intergenic
965511151 3:169568832-169568854 CCATGTTTAGTGCTTTCTTCAGG - Intronic
965635118 3:170772950-170772972 GGAGCTTTACTGATGTTTTCAGG - Intronic
967248184 3:187509828-187509850 GCAGGGCTACTGCTGTTTGCTGG + Intergenic
967339065 3:188376857-188376879 CCAGGTTTAGTGCTTTCTTCAGG + Intronic
967637612 3:191822148-191822170 CCAAGTTTAGTGCTTCTTTCAGG - Intergenic
970496442 4:16630427-16630449 CCATGTTTAGTGCTTTCTTCAGG - Intronic
970689034 4:18601277-18601299 CCATGTTTAGTGCTTTCTTCAGG + Intergenic
970756362 4:19431293-19431315 GCAGGTTAAGCTCTGGTTTCTGG - Intergenic
971560987 4:28079272-28079294 CCATGTTTAGTGCTTCTTTCAGG - Intergenic
971586266 4:28408763-28408785 CCATGTTTAGTGCTTCTTTCAGG - Intergenic
973640596 4:52899301-52899323 CCATGTTTAGTGCTTCTTTCAGG + Intronic
973683165 4:53341947-53341969 CCATGTTTAGTGCTTCTTTCAGG - Intronic
974966922 4:68772366-68772388 CCATGTTTAGTGCTTCTTTCAGG + Intergenic
975305957 4:72848763-72848785 CCATGTTTAGTGCTGCCTTCAGG - Intergenic
975449476 4:74507305-74507327 CCACGTTTAGTGCTTTCTTCAGG - Intergenic
975528916 4:75380099-75380121 GCATGTTTAGTGCTTCCTTCAGG - Intergenic
976024768 4:80674173-80674195 TCATGTTTAGTGCTTCTTTCAGG + Intronic
976451181 4:85193149-85193171 CCAGGTTTAGTGCTTCCTTCAGG + Intergenic
976477763 4:85504871-85504893 CCATGTTTAGTGCTTCTTTCAGG + Intronic
976574586 4:86655393-86655415 CCATGTTTAGTGCTTCTTTCAGG + Intronic
977496370 4:97779921-97779943 CCATGTTTAGTGCTTCTTTCAGG - Intronic
978108491 4:104932552-104932574 CCATGTTTAGTGCTTTCTTCAGG - Intergenic
978662999 4:111151192-111151214 CCATGTTTAGTGCTTTCTTCAGG + Intergenic
979581577 4:122366792-122366814 CCATGTTTAGTGCTTTCTTCAGG - Intergenic
979739296 4:124129966-124129988 GCATGTTTAGTGCTTCCTTCAGG + Intergenic
980597148 4:134969194-134969216 GCATGTTTAGTGCTTCCTTCAGG + Intergenic
981512877 4:145576327-145576349 CCATGTTTAGTGCTTTCTTCAGG - Intergenic
981547745 4:145911481-145911503 ATAGGTCTAGTACTGTTTTCTGG - Intronic
981706967 4:147669920-147669942 GCTGGTTTGGTTCTGTTTTCAGG - Intronic
981846728 4:149177835-149177857 CCATGTTTAGTGCTTTCTTCAGG - Intergenic
982733792 4:158983634-158983656 CCATGTTTAGTGCTTTCTTCAGG - Intronic
983362478 4:166744359-166744381 GCAGGTTTGTTGGAGTTTTCTGG - Intronic
983362593 4:166745478-166745500 CCATGTTTAGTGCTTTCTTCAGG - Intronic
983377599 4:166949925-166949947 GCATGTTTAGTGCTTCCTTCAGG - Intronic
983830940 4:172328036-172328058 TCATATTTAGTGCTCTTTTCAGG + Intronic
984736214 4:183110827-183110849 GCATGTGCAGTGTTGTTTTCTGG + Intronic
985161850 4:187052477-187052499 CCATGTTTAGTGCTTTCTTCAGG - Intergenic
1202759262 4_GL000008v2_random:95420-95442 GCATGTTTAGTGCTTCCTTCAGG + Intergenic
986878023 5:12134184-12134206 CCATGTTTAGTGCTCCTTTCAGG - Intergenic
987676336 5:21077374-21077396 GGAGGTTGAGTGGTGTTTTATGG + Intergenic
987866641 5:23549182-23549204 TCAGGTTTAGTGCAGTGCTCTGG - Intergenic
989337718 5:40337877-40337899 CCATGTTTAGTGCTTCTTTCAGG - Intergenic
989682226 5:44042906-44042928 CCATGTTTAGTGCTTTCTTCAGG - Intergenic
989784812 5:45314352-45314374 CCATGTTTAGTGCTTCTTTCAGG - Intronic
989947833 5:50261132-50261154 CCATGTTTAGTGCTGCCTTCAGG + Intergenic
989968005 5:50488137-50488159 CCAGGTTTAGTGCTTCCTTCAGG + Intergenic
990127393 5:52535214-52535236 CCATGTTTAGTGCTTCTTTCAGG - Intergenic
990230124 5:53704337-53704359 CCACGTTTAGTGCTTCTTTCAGG + Intergenic
991150239 5:63359524-63359546 CCATGTTTAGTGCTTTCTTCAGG + Intergenic
992263248 5:74991644-74991666 GCTGGTTTAGTGAGGCTTTCTGG + Intergenic
992277305 5:75133002-75133024 GCATGTTTAGTGCTTCCTTCAGG - Intronic
992285029 5:75226195-75226217 GCAGGTCTAGAGATGTTGTCTGG - Intronic
992505854 5:77387216-77387238 CCATGTTTAGTGCTTCTTTCAGG + Intronic
992740519 5:79769564-79769586 GCAGGTCTACTGCAGTTTGCTGG + Intronic
992755802 5:79904278-79904300 CCAGGTTTAGTGCTTCCTTCAGG - Intergenic
993253560 5:85558017-85558039 TCATGTTTAGTGCTTCTTTCAGG - Intergenic
993471522 5:88313239-88313261 GCAGGTTTGTTGGAGTTTTCTGG + Intergenic
993494194 5:88588596-88588618 CCATGTTTAGTGCTTCTTTCAGG - Intergenic
994033397 5:95171062-95171084 CCATGTTTAGTGCTTATTTCAGG + Intronic
994545820 5:101164845-101164867 CCATGTTTAGTGCTTTCTTCAGG - Intergenic
995093714 5:108211477-108211499 CCATGTTTAGTGCTTCTTTCAGG + Intronic
995112053 5:108439170-108439192 CCAAGTTTAGTGCTTCTTTCAGG - Intergenic
996130155 5:119771523-119771545 TCATATTTAGTGCTTTTTTCAGG - Intergenic
996639816 5:125739010-125739032 CCATGTTTAGTGCTTCTTTCAGG + Intergenic
996830752 5:127738082-127738104 CCATGTTTAGTGCTTCTTTCAGG + Intergenic
996953999 5:129162186-129162208 CCATATTTAGTGCTGCTTTCAGG + Intergenic
999338433 5:150744780-150744802 CCATGTTTAGTGCTTCTTTCAGG - Intronic
999542460 5:152588336-152588358 CCATGTTTAGTGCTTCTTTCAGG - Intergenic
999559929 5:152789538-152789560 CCATGTTTAGTGCTACTTTCAGG - Intergenic
1000100420 5:158011117-158011139 GCACTTTTCCTGCTGTTTTCTGG + Intergenic
1000340250 5:160271513-160271535 GCAGGCTTAGAGCTGTTTCAGGG - Intronic
1002657326 5:180760821-180760843 CCATGTTTAGTGCTTCTTTCAGG + Intergenic
1002956131 6:1866728-1866750 GCAGGCTTTCTGCTCTTTTCTGG - Intronic
1003248955 6:4407634-4407656 CCATATTTAGTGCTGCTTTCAGG - Intergenic
1003296470 6:4834225-4834247 CCATGTTTAGTGCTTCTTTCAGG + Intronic
1003388337 6:5690349-5690371 GCATGTTTAGTGCTTCCTTCAGG + Intronic
1003434222 6:6070868-6070890 CCATGTTTAGTGCTTTGTTCAGG + Intergenic
1005358085 6:25004150-25004172 CCAGATTTAGTGCTTTTTTGAGG - Intronic
1005911601 6:30314906-30314928 GTTGGTTGAGTGCTGCTTTCAGG - Intergenic
1007155466 6:39738377-39738399 GCATGTTTAGTGCTTCCTTCAGG - Intergenic
1007976133 6:46103343-46103365 GCAGGGTTACTTCTGTTTGCAGG - Intergenic
1008338012 6:50329755-50329777 GCAGTTTTAGAGATCTTTTCTGG - Intergenic
1008350076 6:50479483-50479505 CCATGTTTAGTGCTTCTTTCAGG - Intergenic
1009240991 6:61185442-61185464 CCATGTTTAGTGCTTCTTTCAGG - Intergenic
1009518924 6:64657506-64657528 CCAAGTTTAGTGCTTCTTTCAGG + Intronic
1009719821 6:67453865-67453887 GCTGGTTGAGTGTTTTTTTCTGG + Intergenic
1010344054 6:74790768-74790790 CCATGTTTAGTGCTTTCTTCAGG - Intergenic
1010421956 6:75686547-75686569 CCATGTTTAGTGCTTCTTTCAGG + Intronic
1010876728 6:81116204-81116226 CCATGTTTAGTGCTTTCTTCAGG + Intergenic
1012343368 6:98156411-98156433 GCAGGTCTGCTGCAGTTTTCTGG + Intergenic
1012595027 6:101029495-101029517 CCATGTTTAGTGCTTCTTTCAGG + Intergenic
1012598177 6:101063984-101064006 CCATGTTTAGTGCTTTCTTCAGG - Intergenic
1012653947 6:101792359-101792381 GCATGTTTAGTGCTTCCTTCAGG + Intronic
1014959997 6:127671574-127671596 CCATGTTTAGTGCTTTCTTCAGG + Intergenic
1015109013 6:129569841-129569863 GCAGGTCTGCTGCTGTTTTCTGG - Intergenic
1017762609 6:157582386-157582408 CCATATTTAGTGCTCTTTTCAGG + Intronic
1018619795 6:165719091-165719113 GCTGGTTTTGTTCTATTTTCTGG - Intronic
1020349235 7:7200192-7200214 CCATGTTTAGTGCTGCCTTCAGG + Intronic
1020539160 7:9438369-9438391 GCATGTTTAGTGCTTCCTTCAGG - Intergenic
1022900075 7:34799556-34799578 GCATGTTTAGTGCTTCCTTCAGG - Intronic
1023084503 7:36557136-36557158 CCATGTTTAGTGCTTCTTTCAGG + Intronic
1027303444 7:76866828-76866850 GCAATTTTAGTACTGTTTTATGG + Intergenic
1027415384 7:77968551-77968573 GCAGGCTTTGTGCTGATTTAAGG - Intergenic
1027927820 7:84489479-84489501 GCATGTTTAGAGCAGTTTCCAGG + Intronic
1027994565 7:85409230-85409252 GCAGTTTTAGTGCTTGTTTATGG + Intergenic
1028013413 7:85677968-85677990 CCATGTTTAGTGCTTTTTTCAGG + Intergenic
1028562159 7:92187893-92187915 CCATGTTTAGTGCTTTCTTCAGG + Intergenic
1030256072 7:107509889-107509911 CCATGTTTAGTGCTTCTTTCAGG - Intronic
1030793336 7:113756654-113756676 CCAGGTTTAGTGCTTTCTTCAGG - Intergenic
1030801542 7:113858258-113858280 CCATGTTTAGTGCTTTCTTCAGG - Intergenic
1032312349 7:130800467-130800489 CCAGGTTTAGTGCTTCCTTCAGG + Intergenic
1032925433 7:136599100-136599122 GCATGTTTAGGGCTTCTTTCAGG - Intergenic
1032944924 7:136839105-136839127 GCAAGTGTTGAGCTGTTTTCAGG - Intergenic
1033624018 7:143090256-143090278 GCATGTTTAGTGCTTCCTTCAGG - Intergenic
1038628578 8:29218661-29218683 GCAGTTTTATTTGTGTTTTCTGG - Intronic
1040374657 8:46813094-46813116 CCATGTTTAGTGCTTTCTTCAGG - Intergenic
1040437101 8:47401322-47401344 CCATGTTTAGTGCTTTCTTCAGG - Intronic
1041302876 8:56431071-56431093 CCATGTTTAGTGCTTTCTTCAGG - Intergenic
1041885478 8:62802604-62802626 CCATGTTTAGTGCTTCTTTCAGG - Intronic
1041951515 8:63508896-63508918 CCATGTTTAGTGCTTTTTTCAGG + Intergenic
1042541270 8:69909260-69909282 GCATGTTTAGTGCTTCCTTCAGG - Intergenic
1042731269 8:71937998-71938020 CCATGTTTAGTGCTTCTTTCAGG + Intronic
1042833648 8:73057745-73057767 CCATGTTTAGTGCTTTCTTCAGG - Intergenic
1043157658 8:76804935-76804957 GCATGTTCAGAGCAGTTTTCAGG - Intronic
1043534082 8:81181534-81181556 GATGGATTAGTGATGTTTTCAGG + Intergenic
1043791040 8:84468295-84468317 CCATGTTTAGTGCTTCTTTCAGG + Intronic
1043864153 8:85356752-85356774 GCAGCTTTATTTCTGATTTCAGG - Intronic
1044829958 8:96237462-96237484 TCAGCTTTAGTGCTGTATACAGG - Intergenic
1045143459 8:99313403-99313425 GCAGGTCTATTGGAGTTTTCTGG + Intronic
1047931733 8:129734653-129734675 CCATGTTTAGTGCTCTTTTAGGG - Intergenic
1048193063 8:132308012-132308034 GAAGCTTTAGTGCTTGTTTCTGG - Intronic
1048460989 8:134621798-134621820 GTAGTTTTAATGCTGTTTCCAGG - Intronic
1048853668 8:138668703-138668725 GCAGGCCTAGTGCTGTGTGCTGG + Intronic
1049376200 8:142290270-142290292 GCAGTTCTGGTGCTGTTCTCGGG + Intronic
1050147936 9:2590131-2590153 GCAGGTTTTGCCTTGTTTTCTGG - Intergenic
1050329712 9:4533053-4533075 CCATGTTTAGTGCTTCTTTCAGG - Intronic
1050404693 9:5295003-5295025 CCATGTTTAGTGCTGCCTTCAGG - Intergenic
1050442696 9:5682310-5682332 CCACGTTTAGTGCTTCTTTCAGG + Intronic
1050787887 9:9427902-9427924 CCACGTTTAGTGCTTCTTTCAGG - Intronic
1051303150 9:15675524-15675546 CCATGTTTAGTGCTTTCTTCAGG + Intronic
1051348796 9:16179181-16179203 GCAAGTTGAGTCCTGTTTTCTGG + Intergenic
1051880582 9:21835804-21835826 GCAGGTGTATTGCTGTTTATAGG + Intronic
1051905833 9:22093969-22093991 CCATGTTTAGTGCTTTCTTCAGG + Intergenic
1051987437 9:23107069-23107091 CCATGTTTAGTGCTTCTTTCAGG - Intergenic
1052132044 9:24859776-24859798 CCAGGTTTAGTGCTTCCTTCAGG - Intergenic
1052349181 9:27440917-27440939 GCAGGGTTAGGGTTGGTTTCAGG + Intronic
1052546857 9:29890612-29890634 ACATGTTTAGTGCTTCTTTCAGG - Intergenic
1052814206 9:33087409-33087431 GCATGTTTAGTGCTTCCTTCAGG - Intergenic
1053583105 9:39427272-39427294 CCATGTTTAGTGCTTCTTTCAGG - Intergenic
1054104686 9:60986015-60986037 CCATGTTTAGTGCTTCTTTCAGG - Intergenic
1056674299 9:88660880-88660902 CCAGGTTTCATGCTGTGTTCAGG - Intergenic
1058081768 9:100708616-100708638 CCATGTTTAGTGCTTTCTTCAGG + Intergenic
1059913049 9:119067569-119067591 GCATGTTTAGTGCTTCCTTCAGG + Intergenic
1061552196 9:131343529-131343551 CCATGTTTAGTGCTTTCTTCAGG + Intergenic
1203459932 Un_GL000220v1:25683-25705 GCAGGTCCAGTGCAGTTTGCTGG + Intergenic
1203511891 Un_KI270741v1:127542-127564 CCACGTTTAGTGCTTTCTTCAGG + Intergenic
1203540043 Un_KI270743v1:80319-80341 GCATGTTTAGTGCTTCCTTCAGG + Intergenic
1186599503 X:11022124-11022146 CCATGTTTAGTGCTTCTTTCAGG + Intergenic
1187605302 X:20875480-20875502 GCAGGTCTACTGCAGTTTGCTGG - Intergenic
1187646184 X:21349230-21349252 GCAGGTTTACTGCTTTGTTGGGG - Intergenic
1187684919 X:21806482-21806504 GAATGTTTAATGATGTTTTCAGG + Intergenic
1188129919 X:26419027-26419049 GCAGGTCTGGTGCAGTTTGCTGG + Intergenic
1188474853 X:30580832-30580854 TCAGGTTCAGTGATGTCTTCAGG + Intergenic
1188597419 X:31918379-31918401 GCAAGTTTAGTGATCTTTCCAGG + Intronic
1190092100 X:47447981-47448003 GCACGCTTAGTGTTGATTTCTGG + Exonic
1190593024 X:52024586-52024608 CCATGTTTAGTGCTTTCTTCAGG + Intergenic
1190963635 X:55277374-55277396 GCAGGTCTGCTGCAGTTTTCTGG + Intronic
1191063377 X:56321630-56321652 CCATGTTTAGTGCTTTCTTCAGG - Intergenic
1191087537 X:56585673-56585695 CCATGTTTAGTGCTTCTTTCAGG + Intergenic
1191168348 X:57416380-57416402 CCATGTTTAGTGCTTTCTTCAGG + Intronic
1191882242 X:65854791-65854813 CCAGGTTTAGTGCTTCCTTCAGG + Intergenic
1191984521 X:66965242-66965264 GCATGTTTAGTGCTTCCTTCAGG + Intergenic
1192007837 X:67236065-67236087 GCATGTTTAGTGCTTCCTTCAGG - Intergenic
1192030913 X:67511197-67511219 CCATATTTAGTGCTTTTTTCAGG - Intergenic
1192091469 X:68161806-68161828 GGACGTTTATTGCTGCTTTCAGG - Intronic
1192391229 X:70730148-70730170 CCATGTTTAGTGCTTCTTTCAGG - Intronic
1192679006 X:73231578-73231600 CCAGGTTTAGTGCTTCCTTCAGG - Intergenic
1192721519 X:73703393-73703415 CCACGTTTAGTGCTTCTTTCAGG - Intergenic
1192729578 X:73789719-73789741 CCATATTTAGTGCTTTTTTCAGG + Intergenic
1192741224 X:73894508-73894530 CCATGTTTAGTGCTTCTTTCAGG - Intergenic
1192922643 X:75723860-75723882 GCAGGTTTACTGGAGTTTGCTGG + Intergenic
1192964386 X:76161306-76161328 CCATGTTTAGTGCTTTCTTCAGG - Intergenic
1193000867 X:76560443-76560465 GCAGGTCTGTTGCTGTTTGCTGG - Intergenic
1193343685 X:80382221-80382243 GCAGGTCTATTGGAGTTTTCTGG + Intronic
1193404576 X:81084797-81084819 GCAGGTCTGCTGCAGTTTTCTGG - Intergenic
1193426224 X:81344031-81344053 CCATGTTTAGTGCTTCTTTCAGG + Intergenic
1193806754 X:86004252-86004274 CCATGTTTAGTGCTTCTTTCAGG - Intronic
1193835448 X:86337552-86337574 CCATGTTTAGTGCTTCTTTCAGG - Intronic
1194118787 X:89935969-89935991 CCATGTTTAGTGCTTCTTTCAGG + Intergenic
1194191156 X:90838199-90838221 CCATGTTTAGTGCTTCTTTCAGG - Intergenic
1194353717 X:92855317-92855339 GCAGGTTCAGTTCTGTACTCAGG + Intergenic
1195417358 X:104634994-104635016 CCATGTTTAGTGCTTTCTTCAGG + Intronic
1195558091 X:106250289-106250311 GCAGTTTTTATCCTGTTTTCAGG + Intergenic
1196260784 X:113578391-113578413 CCAGTTTTAGAGCTGTTTACAGG - Intergenic
1196269594 X:113696062-113696084 CCATGTTTAGTGCTTTCTTCAGG + Intergenic
1196473526 X:116056624-116056646 CCATATTTAGTGCTTTTTTCAGG + Intergenic
1196944848 X:120813500-120813522 CCATGTTTAGTGCTTCTTTCAGG - Intergenic
1198550612 X:137741607-137741629 GCAGGTGTAGTTCTGTTTTTAGG + Intergenic
1198581995 X:138075380-138075402 GCATGTTTAGTGCTTCCTTCAGG - Intergenic
1198663576 X:138997056-138997078 GCAGGTCTATTGCAGTTTGCTGG - Intronic
1199662890 X:150070261-150070283 CCATGTTTAGTGCTATCTTCAGG + Intergenic
1200290558 X:154868536-154868558 CCATGTTTAGTGCTTCTTTCAGG - Intronic
1200333438 X:155321554-155321576 CCATGTTTAGTGCTTCTTTCTGG - Intronic
1200471661 Y:3593531-3593553 CCATGTTTAGTGCTTCTTTCAGG + Intergenic
1200537810 Y:4420614-4420636 CCATGTTTAGTGCTTCTTTCAGG - Intergenic
1200662078 Y:5972389-5972411 GCAGGTTCAGTTCTGTACTCAGG + Intergenic
1201425818 Y:13850078-13850100 CCATGTTTAGTGCTTCTTTCAGG + Intergenic
1201435489 Y:13953801-13953823 CCAGGTTTAGTACTTCTTTCAGG - Intergenic
1201476672 Y:14390051-14390073 CCATGTTTAGTGCTTCTTTCAGG + Intergenic
1201582949 Y:15530419-15530441 TCAGGTTTAGTGCTTCCTTCAGG + Intergenic
1201946480 Y:19515667-19515689 GCAGGTCTACTGCAGTTTGCTGG - Intergenic
1202040380 Y:20676449-20676471 CCATGTTTAGTGCTTTCTTCAGG - Intergenic
1202085016 Y:21127668-21127690 CCAGGTTTAGTGCTTCCTTCAGG + Intergenic