ID: 1077522897

View in Genome Browser
Species Human (GRCh38)
Location 11:3046729-3046751
Sequence CTCCACCTTCATGTGGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 254}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077522897_1077522904 -1 Left 1077522897 11:3046729-3046751 CCTGCCCCCACATGAAGGTGGAG 0: 1
1: 0
2: 2
3: 21
4: 254
Right 1077522904 11:3046751-3046773 GGAGTGCCCACAGCCACAGGAGG 0: 1
1: 0
2: 2
3: 26
4: 231
1077522897_1077522903 -4 Left 1077522897 11:3046729-3046751 CCTGCCCCCACATGAAGGTGGAG 0: 1
1: 0
2: 2
3: 21
4: 254
Right 1077522903 11:3046748-3046770 GGAGGAGTGCCCACAGCCACAGG 0: 1
1: 0
2: 6
3: 49
4: 343
1077522897_1077522908 6 Left 1077522897 11:3046729-3046751 CCTGCCCCCACATGAAGGTGGAG 0: 1
1: 0
2: 2
3: 21
4: 254
Right 1077522908 11:3046758-3046780 CCACAGCCACAGGAGGAGCTGGG 0: 1
1: 0
2: 10
3: 591
4: 16089
1077522897_1077522906 5 Left 1077522897 11:3046729-3046751 CCTGCCCCCACATGAAGGTGGAG 0: 1
1: 0
2: 2
3: 21
4: 254
Right 1077522906 11:3046757-3046779 CCCACAGCCACAGGAGGAGCTGG 0: 1
1: 1
2: 6
3: 89
4: 1199
1077522897_1077522910 17 Left 1077522897 11:3046729-3046751 CCTGCCCCCACATGAAGGTGGAG 0: 1
1: 0
2: 2
3: 21
4: 254
Right 1077522910 11:3046769-3046791 GGAGGAGCTGGGCCACCCAAAGG 0: 1
1: 0
2: 4
3: 46
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077522897 Original CRISPR CTCCACCTTCATGTGGGGGC AGG (reversed) Intronic
900369800 1:2326616-2326638 CTGCACCTTCATGCGGGTGCTGG + Intronic
900943130 1:5814123-5814145 CTTCACCCTCAGGTGGGGGGCGG + Intergenic
902288740 1:15423162-15423184 CTCCAGCTCCAGGTGGAGGCTGG + Intronic
903058681 1:20654469-20654491 CTCCCCCTTCAGGTAGGGCCAGG - Intronic
903690168 1:25167693-25167715 TTCCTCTTTGATGTGGGGGCTGG - Intergenic
904768703 1:32869590-32869612 CCCCACCTGCATCTTGGGGCTGG - Intronic
905294861 1:36947744-36947766 ATCCTGCTTCATGGGGGGGCAGG - Intronic
906906805 1:49903338-49903360 CTCCACCCTCAAGTGGGCTCTGG - Intronic
909013623 1:70360483-70360505 CTCCAGATTTATGTGGGAGCAGG - Intronic
911288694 1:96028789-96028811 CTCTACCTTCAGGTCGGGGAAGG - Intergenic
911491866 1:98579241-98579263 CTCCACCCTCAAGTAGGTGCTGG + Intergenic
913967433 1:143388699-143388721 CACCGCCTTCATGTGGGTGTGGG - Intergenic
914061808 1:144214293-144214315 CACCGCCTTCATGTGGGTGTGGG - Intergenic
914117342 1:144752061-144752083 CACCGCCTTCATGTGGGTGTGGG + Intergenic
915936216 1:160091710-160091732 CTCCTCCTCCAGGTGGGGCCTGG + Intronic
916194258 1:162208865-162208887 CACCACCTTCATGTGAGGCTGGG + Intronic
916931095 1:169578804-169578826 TACCACCTTCATGGGGGGCCAGG - Intronic
917456673 1:175192056-175192078 CTCTACCTTCATGGGTGGGATGG + Intronic
917523431 1:175766786-175766808 CACCTTCTTCATGTGGTGGCAGG - Intergenic
918212711 1:182365801-182365823 CTCCAGCTTCATGTCAGAGCAGG - Intergenic
919195392 1:194278518-194278540 CTCCACCTTCAAGAAGGGCCTGG - Intergenic
919727407 1:200893406-200893428 CTCCAGCTCCAGGTGGGGGTTGG - Intronic
919745375 1:201005377-201005399 CTGCACGTTCATCTGGGTGCTGG + Exonic
919975299 1:202606680-202606702 CTACAGCTGCATGTGGGGGCAGG - Intronic
923007983 1:230067310-230067332 CTTCGCCTTCCTGTGGGTGCTGG + Exonic
924679708 1:246219736-246219758 CTGCAGCTGCATCTGGGGGCTGG - Intronic
924745595 1:246830895-246830917 CTCCACCTTCCTGAGCTGGCAGG - Intergenic
1063407762 10:5813247-5813269 CTCCTCATTCATGGCGGGGCAGG + Exonic
1064622519 10:17229718-17229740 CTCCACCTTCTCGTTGGTGCGGG - Exonic
1066078148 10:31901779-31901801 TTCCACCTTCTTGTGGCTGCTGG + Intronic
1066349715 10:34625947-34625969 CCCCATCTTAATGTGGGGACAGG + Intronic
1067030684 10:42877383-42877405 CACCACCTTCATGTGTGTGTTGG - Intergenic
1071668833 10:87587996-87588018 CTTCACCTTCATTTAGGGGCTGG - Intergenic
1071687291 10:87773005-87773027 CTCCAGCTTCATCTGGAGGAGGG + Intronic
1072828142 10:98629212-98629234 CTCCAGCTTCATTTGGAGGGTGG - Intronic
1072896055 10:99367845-99367867 CTCCCCCTTCAAGTGGTGTCTGG - Intronic
1073490385 10:103849428-103849450 CTCCCCCTTCTTATGGGGTCTGG + Intronic
1073492638 10:103864252-103864274 CTCCACCTTGATCTGGGTGGAGG + Intergenic
1075175476 10:120156665-120156687 CTCCACCTTCCAGTGGGAACTGG - Intergenic
1075315460 10:121449703-121449725 CTCCACATTCAGGTGGGGAGTGG - Intergenic
1076612358 10:131734278-131734300 TTCCACCTTCATTGGGGGACTGG - Intergenic
1077161227 11:1113549-1113571 CTGCCCCTTCAGGTGGAGGCAGG + Intergenic
1077522897 11:3046729-3046751 CTCCACCTTCATGTGGGGGCAGG - Intronic
1077533505 11:3108110-3108132 CTGCAGCTGGATGTGGGGGCAGG - Intronic
1078152927 11:8774616-8774638 GCCCAGCTTCATGTGGGGCCAGG - Intronic
1078734755 11:14009782-14009804 CTGCATCTTCATGTGGAGGAAGG + Intronic
1080797734 11:35581008-35581030 GTCCACGTCCATGTGGTGGCTGG - Intergenic
1081192069 11:40116174-40116196 CTTCAACTTCTTGTGGTGGCTGG - Exonic
1083651656 11:64207939-64207961 CTGTAACTTCCTGTGGGGGCAGG - Intronic
1083856493 11:65395656-65395678 CTCCTCCTTCATGTGGGGCGGGG + Intronic
1084410693 11:69004514-69004536 GTCCACTTTCGGGTGGGGGCTGG + Exonic
1084509983 11:69597360-69597382 CCCCTCCTACTTGTGGGGGCTGG - Intergenic
1084647464 11:70466799-70466821 AGCCACCTGCATCTGGGGGCCGG - Intergenic
1087360388 11:97151281-97151303 CTCCACCTTCAAGTAGGCCCTGG + Intergenic
1087517384 11:99181220-99181242 CTCCCCGTCCAAGTGGGGGCAGG + Intronic
1088953604 11:114595801-114595823 CTCCACCTTAAGGAGGGGCCTGG + Intergenic
1091141607 11:133239840-133239862 CTCCACCACCAGGTAGGGGCTGG + Intronic
1091663690 12:2403215-2403237 CTTCACCTTGATTTTGGGGCAGG - Intronic
1092579817 12:9826857-9826879 CTCCACCTTCAAGTAGGCTCCGG - Intergenic
1096110606 12:49027049-49027071 CTTCACCTTCTTCAGGGGGCCGG + Exonic
1097377824 12:58859871-58859893 GTCCTTCTTCATGTGGGGGACGG + Intergenic
1101216633 12:102592594-102592616 CTCCCCCTTCCTGTGAGGGGTGG - Intergenic
1101860745 12:108480484-108480506 CTTCACCATCATGTGGGGAGAGG + Intergenic
1102579521 12:113877367-113877389 CTCCACCTCCCTGTAGGGTCTGG - Intronic
1103804695 12:123563262-123563284 CTCCACCTGCAAATGGGGGGAGG - Intergenic
1103978221 12:124717722-124717744 CTCCATCTTCAGGTAGGGCCCGG - Intergenic
1103999616 12:124852208-124852230 CTCCACCTTCATGCTGGGGCAGG + Intronic
1104455928 12:128912047-128912069 CTCCACCTCCACGCAGGGGCGGG + Intronic
1104591439 12:130087342-130087364 CTCCTCCTTCCTGTGGCGACTGG - Intergenic
1109476435 13:62885688-62885710 CTCCACCCTCAAGTAGGGTCTGG + Intergenic
1110046737 13:70841629-70841651 CTGCATTTTCAGGTGGGGGCAGG - Intergenic
1113367847 13:109693401-109693423 CTCCAGCTTCTGGTGGTGGCTGG - Intergenic
1113595361 13:111528086-111528108 ATGCACCTCCATGTGGTGGCAGG - Intergenic
1113946676 13:114048438-114048460 CTCCACCTTCCTCTGGGCCCCGG - Intronic
1114155626 14:20099609-20099631 CTCCACCTGCAGCTGGGTGCGGG + Intergenic
1114844191 14:26301192-26301214 CTGCATCTTCATGTGGTGGAAGG - Intergenic
1114972511 14:28050750-28050772 CTCCACCTTCAAGTAGGCCCTGG + Intergenic
1116219423 14:42063769-42063791 CTCCACATTCATGTAGGTCCTGG + Intergenic
1118074175 14:62280455-62280477 ATCCACCATCATGGGGTGGCTGG - Intergenic
1118081205 14:62362756-62362778 CTCTACCTTCAAGTAGGGCCTGG + Intergenic
1119622217 14:76139486-76139508 CTCTACCTTCCTCTGGGGACAGG - Intergenic
1121553732 14:94820820-94820842 CTCCAGCTTCCTGTGGGGTTTGG - Intergenic
1123040252 14:105487436-105487458 CTCCACCCTCATCCCGGGGCAGG - Intronic
1124490957 15:30155025-30155047 GTGCAGCTGCATGTGGGGGCAGG - Intergenic
1124752577 15:32383306-32383328 GTGCAGCTGCATGTGGGGGCAGG + Intergenic
1125397050 15:39260373-39260395 TTCCACCTTCCTGTGTGGACAGG + Intergenic
1127526839 15:59801572-59801594 CTCTCCCTTTATGTGTGGGCTGG - Intergenic
1128671427 15:69577202-69577224 CTGCTCCTTCCTGCGGGGGCAGG + Intergenic
1129686613 15:77689587-77689609 CCCGACCTCCATGTGGGGGGTGG + Intronic
1129699098 15:77757367-77757389 CTCCAGCATCATATGGGGGGTGG + Intronic
1131022340 15:89109435-89109457 CTCCACCTTCATGATGGGCTGGG - Intronic
1132726236 16:1339479-1339501 CTCCACCTGCAGGTGGGGGAAGG - Exonic
1133758238 16:8778347-8778369 CTCCACCTTCTCGTGGCTGCCGG + Intronic
1135789967 16:25384795-25384817 CACCTTCTTCATGTGGTGGCAGG - Intergenic
1135952668 16:26929829-26929851 CTCCACCTTCAAGTAGGCTCCGG + Intergenic
1136075335 16:27813247-27813269 CTCCACCTTCAAGTAGGTCCTGG + Intronic
1138496637 16:57412953-57412975 GTCCACTTTCCAGTGGGGGCAGG - Intronic
1138582745 16:57952254-57952276 CTCCACCTTCCTGTGTGGCCTGG - Intronic
1139183105 16:64770675-64770697 CTCCACCTTCAAGCTGGGGAAGG + Intergenic
1139275397 16:65723195-65723217 CTCCACCCTCAAGTGGGTCCTGG + Intergenic
1139464817 16:67148871-67148893 CTCCACCTCCCTGTGGGGCCTGG + Exonic
1140040362 16:71403450-71403472 CTCCACATTCAAGATGGGGCAGG - Intergenic
1140942128 16:79731982-79732004 CTCCACCCTCAAGTGGGCCCTGG - Intergenic
1142669868 17:1483120-1483142 CTCCACCCAGATGTGGGAGCGGG - Intronic
1143361764 17:6376993-6377015 CTACAGCTTCAGGTAGGGGCTGG - Intergenic
1145738036 17:27247343-27247365 ATCCACCTTCATCTGGGGAGTGG + Intergenic
1147046243 17:37754543-37754565 CTCCACCTGCATGTGGTGTGGGG - Intergenic
1147464108 17:40597644-40597666 CTCCACCTGAATCTGAGGGCAGG - Intergenic
1147910646 17:43853966-43853988 GTCCAGCTGCATGGGGGGGCGGG - Exonic
1149127632 17:53254761-53254783 AACCACCTTCATGTTTGGGCTGG - Intergenic
1150604356 17:66678224-66678246 TTCCACCTTCCAGTGGTGGCAGG - Intronic
1151185945 17:72363921-72363943 TTCCACCTTCAGGTGAAGGCTGG + Intergenic
1151495320 17:74454904-74454926 CCCCACCCTGATGTGGGTGCTGG + Intergenic
1151826091 17:76525208-76525230 CTCCATCGTCGGGTGGGGGCTGG + Intergenic
1151933539 17:77247789-77247811 CTCCCCCTCCATGTGAGGGTGGG + Intergenic
1152077809 17:78169548-78169570 CTTCATCTCCATCTGGGGGCGGG + Intronic
1152558582 17:81066832-81066854 CTCCACCTGCAGGAGGAGGCTGG - Intronic
1152575560 17:81139297-81139319 CCCCACCTGCTAGTGGGGGCTGG - Intronic
1152906763 17:82974679-82974701 CTCAGCCTTGATGTGGGGCCAGG - Intronic
1153348670 18:4055438-4055460 CTCCACCCTCAAGTGGGCCCCGG + Intronic
1156618735 18:38822345-38822367 CTCCACCTTCAAGTAGGCCCTGG - Intergenic
1157006434 18:43589694-43589716 CTCCACCTTCAAGCCGGGGAGGG - Intergenic
1157938503 18:51899197-51899219 CTCCACCTTCAAGTAGGCCCTGG + Intergenic
1160254580 18:77237126-77237148 CTCCATCTTCATATGGCAGCAGG - Intergenic
1162809297 19:13154531-13154553 CTGCACCTTCGGGTGGGAGCGGG + Exonic
1164859879 19:31554519-31554541 CTCCACCGTCATGTGAAGGTGGG + Intergenic
1165078903 19:33296648-33296670 CTCCACCCTGTTGTGGCGGCCGG - Intergenic
1167260503 19:48455311-48455333 CCCCACCTACTGGTGGGGGCTGG - Exonic
1168058016 19:53874237-53874259 CCCCAGCTTCCTGTCGGGGCTGG + Exonic
1202701219 1_KI270712v1_random:166167-166189 CACCGCCTTCATGTGGGTGTGGG - Intergenic
925913081 2:8586029-8586051 CTACACCTGCAGGTGGGGGGTGG + Intergenic
931096252 2:58943869-58943891 ATCCTTCTTCATGTGGTGGCAGG - Intergenic
932506317 2:72235391-72235413 CTCCACCTTCAAGTAGGCCCTGG - Intronic
932825401 2:74934425-74934447 CTCCTCCTTCATCTGGGGTGAGG + Intergenic
934282448 2:91623956-91623978 CACCGCCTTCATGTGGGTGTGGG - Intergenic
936909565 2:117576176-117576198 CTCCTTCTTCACGTGGTGGCAGG + Intergenic
940531444 2:154882803-154882825 CTCCACCTTCAAGTAGGCTCTGG + Intergenic
942314289 2:174683237-174683259 CTCCACCTTCTTGCGGCTGCTGG + Intergenic
944471799 2:200061620-200061642 CTCCACCTTCAAGTAGGCCCTGG - Intergenic
946090107 2:217214653-217214675 CTCCATCTTCATGGTAGGGCTGG + Intergenic
948586652 2:239024133-239024155 ATCCTGCTTCATGTGGTGGCAGG + Intergenic
1171463420 20:25311621-25311643 CTTCACCTTCTTGTGGGGGCAGG - Intronic
1172128951 20:32643074-32643096 GTGCACCTTCATGCGGCGGCTGG - Intergenic
1172280295 20:33703188-33703210 TTTCACCTTCAGCTGGGGGCAGG + Exonic
1172938631 20:38639211-38639233 CCCCGCCTTCCTGTAGGGGCTGG + Exonic
1174354788 20:49990482-49990504 CTCCTCCTTCAGGTCCGGGCTGG - Intergenic
1174754226 20:53141941-53141963 CTTCACCTCCATCTGTGGGCAGG + Intronic
1175795330 20:61767177-61767199 CTGCATGCTCATGTGGGGGCGGG - Intronic
1175855257 20:62117706-62117728 CTCAGCCTTCAGGTTGGGGCGGG - Intergenic
1175920205 20:62447023-62447045 CTACATCTTCATGGGTGGGCGGG - Intergenic
1176243072 20:64083970-64083992 CTCCACCTTCCCGTGCGGGTCGG - Exonic
1177940315 21:27402165-27402187 CTCCACCATCAGGTAGGGCCCGG + Intergenic
1179587760 21:42384501-42384523 CTCCACCTGTGTGTGGGGGTGGG - Intronic
1179986166 21:44921370-44921392 ATCCACCTGCATGTGAGGGCGGG + Intronic
1180178954 21:46109460-46109482 CCCCACCTTCAGGCTGGGGCAGG - Intronic
1183751515 22:39723670-39723692 CTCCATCATCACATGGGGGCTGG - Intergenic
1183954145 22:41369089-41369111 CTCGCCCTTCATGTGTGTGCTGG - Intronic
1184164001 22:42716802-42716824 CTTCCCCTTCAGGTGGGGGTAGG - Intronic
1184344954 22:43907522-43907544 GTCCAACCTCCTGTGGGGGCTGG + Intergenic
949190015 3:1240823-1240845 ATGCACCTTCACGTGGGTGCAGG + Intronic
950388441 3:12677772-12677794 CTCCACCTTGGGGTGGGGCCAGG + Intergenic
950917628 3:16662186-16662208 GTCCTCCTTCATATGGCGGCAGG - Intronic
951508904 3:23480013-23480035 CTCCACCTTCAGGCTGGGGATGG - Intronic
953202764 3:40792211-40792233 CTCCAGGTTCATGTGGAGGCAGG - Intergenic
956724675 3:72147012-72147034 CTCCACCCTCAAGTAGGCGCTGG + Intergenic
958156651 3:89763055-89763077 GTCCTCCTTCATGTGGTGGCAGG - Intergenic
959534612 3:107470659-107470681 CTCCAGCTTGGTGGGGGGGCAGG + Intergenic
960333840 3:116392638-116392660 CTCCACCTTCTGGTTGGGGAGGG + Intronic
961538403 3:127584071-127584093 CTTCACCTTGCTGTGAGGGCAGG - Intronic
961578314 3:127856711-127856733 CTCCACCTTCAAGTAGGTCCCGG + Intergenic
961831562 3:129625604-129625626 CTGCACCTCCATCTGGGAGCAGG + Intergenic
961842163 3:129723860-129723882 CTGCAGCTTTAAGTGGGGGCTGG - Intronic
962880492 3:139572124-139572146 CTCCAGCTTGAGGTGGGGGCTGG + Intronic
963549297 3:146700325-146700347 TTCCTTCTTCATGTGGTGGCAGG + Intergenic
966320207 3:178694141-178694163 ATCCTCCTTCATGTGGCAGCAGG + Intronic
968296013 3:197577085-197577107 CTACTCCTTCAGGTTGGGGCGGG + Intergenic
968506405 4:973230-973252 CTCCGACTTCATCTGGGGGCTGG - Exonic
969027610 4:4186258-4186280 CACCCCCTTCATGTGGGTGTGGG + Intergenic
969600358 4:8172461-8172483 CGCCATCTGCATGTGTGGGCGGG - Intergenic
969843452 4:9900766-9900788 ATCCTTCTTCATGTGGTGGCAGG + Intronic
970959629 4:21857072-21857094 CCCCACCTTCAAGTGGGGAAAGG + Intronic
972733004 4:41813694-41813716 CTCCATCCTCATGTGGAGGAAGG + Intergenic
972737162 4:41853947-41853969 CTCCATCTTCAAGTGGGCCCTGG - Intergenic
977950208 4:102962060-102962082 CTCAACCTCCAGGTGTGGGCTGG - Intronic
979746574 4:124221688-124221710 TTCCACCTTCTGGTGGGGGTTGG - Intergenic
980131834 4:128823907-128823929 CTTCACATTCATTTAGGGGCAGG + Intronic
981121690 4:141058526-141058548 TTCCACCTTCATGTAGTGGTAGG + Intronic
981351320 4:143733201-143733223 CTCCACCCTCAAGTGGGCCCTGG + Intergenic
985190438 4:187366789-187366811 CTCCAGCTTCAGGTGTGGGCTGG - Intergenic
985527853 5:416090-416112 CTGCACCTTCACGTGGATGCTGG - Intronic
985873748 5:2579282-2579304 GGCCACCTGCATGTGGGGGAGGG - Intergenic
986233500 5:5886954-5886976 CTCCACGTTCGTGTTGGGACCGG - Intergenic
986402557 5:7395338-7395360 CTCCACCCTCTTGAGAGGGCCGG - Intergenic
988329661 5:29818901-29818923 CTCCACCTTCAAGTAGGTCCTGG + Intergenic
991352712 5:65735164-65735186 CTCCTTATTCATGTGGTGGCAGG - Intronic
992693144 5:79259457-79259479 CACCACCTTCAAGTCGGGGAGGG - Intronic
993159143 5:84266331-84266353 CTCCTCTTTCATGTTGGGGCTGG - Intronic
994848139 5:105017097-105017119 CTCCACCTTCATGTAGGCCCTGG - Intergenic
995386600 5:111595996-111596018 CTCCACCTTCAAGCTGGGGTTGG + Intergenic
997749429 5:136330161-136330183 GGCCACCCCCATGTGGGGGCGGG - Intronic
998382027 5:141732413-141732435 CTCAACCTTCCTATGTGGGCAGG - Intergenic
999694695 5:154178742-154178764 CTCCACCCTCATTTCTGGGCTGG - Intronic
999820178 5:155219553-155219575 CTCTACCTTCTGATGGGGGCTGG - Intergenic
1000665720 5:163993749-163993771 CTCCTCCCCCATGTAGGGGCTGG - Intergenic
1000728331 5:164800681-164800703 ATCCCTCTTCACGTGGGGGCAGG + Intergenic
1002170061 5:177369926-177369948 CTCCAGCCTGATGTGGGGGTTGG - Intronic
1006028524 6:31162524-31162546 CTCCCCCTGCAGTTGGGGGCGGG + Exonic
1009505170 6:64468659-64468681 CTCCACCTTCAAGTAGGTCCTGG + Intronic
1009527248 6:64763363-64763385 CTCCTTCTTCATATGGTGGCTGG + Intronic
1009592008 6:65684896-65684918 CTCCACCCTCAAGTGGGCCCCGG + Intronic
1009766074 6:68077299-68077321 ATCCACCTTCATTTGGGGAATGG - Intergenic
1009893498 6:69718606-69718628 GTCCTTCTTCATGTGGCGGCAGG + Intronic
1010898339 6:81393386-81393408 CACCTTCTTCATGTGGTGGCAGG - Intergenic
1011986098 6:93448034-93448056 TTCCAACTACATGTGGGTGCAGG + Intergenic
1013374587 6:109502135-109502157 CTCCTCCCCCATGTGTGGGCTGG + Intronic
1015434720 6:133172565-133172587 CCCCACCTTCAAGTTGGGGAAGG + Intergenic
1016764691 6:147778776-147778798 CTGCACCATCATGTGAGGGCAGG + Intergenic
1018418181 6:163619684-163619706 AAGCACCTTCACGTGGGGGCAGG + Intergenic
1018562521 6:165117422-165117444 ATCCTCTTCCATGTGGGGGCTGG - Intergenic
1019255432 7:46797-46819 CTCCGCCATCGTGTGTGGGCTGG - Intergenic
1019565416 7:1676461-1676483 CTCCTCCGTCATGTGAGGACGGG + Intergenic
1019577714 7:1745540-1745562 CTTGACCTTGATGAGGGGGCGGG - Exonic
1019693820 7:2433319-2433341 CTTGACCTTCATGAGGTGGCGGG - Exonic
1026953763 7:74364242-74364264 CTCCACCTTCCTGCAGGGGAGGG - Exonic
1028020400 7:85764530-85764552 TTCCAGCTTCATGTGGGGTGGGG - Intergenic
1028451128 7:90984547-90984569 CTCCACCTACATGATGGGGAGGG - Intronic
1028455378 7:91032627-91032649 CTCCAGCTTCTGGTGGGTGCTGG - Intronic
1029519008 7:101048187-101048209 CCCCACCTTGATGTGAGGCCAGG + Intronic
1033658439 7:143388369-143388391 CCCCACCGTGATGTGGGGGCAGG - Intronic
1035015332 7:155760908-155760930 TTCCATTTTCATGTGGGGGTTGG + Intronic
1037960267 8:23092624-23092646 CTTCCCCTCCATGTGGGGACAGG + Intronic
1038474660 8:27856682-27856704 CTTCACCTGCCAGTGGGGGCTGG - Intergenic
1039168800 8:34717056-34717078 CTCCACCTTCAAGTGGGCCTTGG + Intergenic
1039443860 8:37614584-37614606 CTCCACCCTCAAGTGGGCCCAGG + Intergenic
1039794170 8:40898015-40898037 CTCCAGCCCAATGTGGGGGCAGG + Intergenic
1043587153 8:81782591-81782613 CTCCACCTTCAAGTAGGCCCTGG + Intergenic
1044301697 8:90591683-90591705 CTCCACCTAAATGTGGGTCCAGG + Intergenic
1046607763 8:116389807-116389829 GTCCTTCTTCATGTGGTGGCAGG - Intergenic
1046867591 8:119167966-119167988 CTCCACCTTCCTGTGTGCCCAGG - Intronic
1049115773 8:140686225-140686247 CTCCACCCTCAAGTGGGCCCCGG - Intronic
1049247551 8:141570936-141570958 GTCCTCCTTCAAGTGGTGGCAGG + Intergenic
1049343832 8:142128045-142128067 CTCCTCCTTCCTGTGGGGGATGG + Intergenic
1049441846 8:142613153-142613175 CTCCACCGGGAGGTGGGGGCCGG + Exonic
1049497076 8:142941002-142941024 AGCCAGCTTCGTGTGGGGGCTGG + Intergenic
1049996937 9:1043183-1043205 CTCCACGGGGATGTGGGGGCGGG - Intergenic
1050243246 9:3659707-3659729 CTCCAAGTTCATGTGGGTGGAGG + Intergenic
1054714317 9:68541982-68542004 CTCTACCTTCATGTTAGGGCTGG + Intergenic
1054941582 9:70748643-70748665 CTGCATCTTCATGTGGTGGAGGG - Intronic
1055361960 9:75501145-75501167 CTCCACCTTCAAGTAGGCCCTGG + Intergenic
1056054534 9:82807215-82807237 GTCCTTCTTCATGTGGTGGCAGG - Intergenic
1056795851 9:89658441-89658463 CTCCACTTCCCTGTGGGAGCAGG + Intergenic
1056925870 9:90834139-90834161 CACCATCTTCAGGTGGGGGTGGG + Intronic
1057481096 9:95446543-95446565 CTCTCCCTTCATCTGGGGGCTGG + Intronic
1058930877 9:109717480-109717502 CTACTCCTTCATGTGGTGTCTGG - Intronic
1059978243 9:119740996-119741018 CTCCACCTTCAAGTAGGCCCCGG + Intergenic
1060734666 9:126059332-126059354 TTCCTCCTGCATGTGGAGGCTGG - Intergenic
1061416828 9:130451590-130451612 CTCCACCTGCAGGTGGGCGGCGG + Exonic
1061509015 9:131049135-131049157 CTCCAGCACCAGGTGGGGGCTGG + Intronic
1062044726 9:134419745-134419767 CTCCACCTCCCTGTGTGGCCTGG - Intronic
1062126104 9:134863918-134863940 CAGCAGCTTCAGGTGGGGGCGGG - Intergenic
1062673325 9:137724319-137724341 CTCTTCCCTCCTGTGGGGGCGGG - Intronic
1185824521 X:3237040-3237062 CTAGACCTTCATGTAGGGACTGG - Intergenic
1186355309 X:8783966-8783988 CTCCGCCTTCATCAGGGAGCTGG + Intergenic
1189767658 X:44388596-44388618 TTCCACTCTCATATGGGGGCTGG + Intergenic
1189788947 X:44584887-44584909 CTCCTTCTTCACCTGGGGGCAGG - Intergenic
1190245182 X:48686103-48686125 CTCCACCTGGATGCAGGGGCAGG - Exonic
1190366659 X:49701032-49701054 CACCTCCTTCATGTGGTGGCAGG - Intergenic
1193085168 X:77442410-77442432 CTCCACCTTCAAGTAGGCCCTGG + Intergenic
1193784653 X:85746111-85746133 CTTCACCTTCATGTAGGCCCTGG - Intergenic
1194660021 X:96620743-96620765 CACCAGCTTCATGTGGGGATAGG + Intergenic
1195580575 X:106496582-106496604 CTCCACCTTCATGGGTGGCTTGG + Intergenic
1195629415 X:107038805-107038827 CTCCACCTTCAAGTAGGCCCCGG - Intergenic
1197758202 X:130010715-130010737 CTCCCCCTTCTTGTTGGGGTTGG + Intronic
1197775907 X:130118514-130118536 CTCAACCCCGATGTGGGGGCAGG - Intergenic
1197778872 X:130139933-130139955 CTCCACCTTTGTGTGGTGGAGGG - Intronic
1200049835 X:153422911-153422933 CACCACACTCATCTGGGGGCAGG - Intergenic
1200061483 X:153485757-153485779 CTCCAGCTTCCTGTGGGGCGGGG - Intronic
1200273984 X:154714616-154714638 CTCCAACTTCATGCCGGGACAGG + Intronic