ID: 1077522899

View in Genome Browser
Species Human (GRCh38)
Location 11:3046733-3046755
Sequence ACTCCTCCACCTTCATGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 176}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077522899_1077522904 -5 Left 1077522899 11:3046733-3046755 CCCCCACATGAAGGTGGAGGAGT 0: 1
1: 0
2: 0
3: 12
4: 176
Right 1077522904 11:3046751-3046773 GGAGTGCCCACAGCCACAGGAGG 0: 1
1: 0
2: 2
3: 26
4: 231
1077522899_1077522908 2 Left 1077522899 11:3046733-3046755 CCCCCACATGAAGGTGGAGGAGT 0: 1
1: 0
2: 0
3: 12
4: 176
Right 1077522908 11:3046758-3046780 CCACAGCCACAGGAGGAGCTGGG 0: 1
1: 0
2: 10
3: 591
4: 16089
1077522899_1077522906 1 Left 1077522899 11:3046733-3046755 CCCCCACATGAAGGTGGAGGAGT 0: 1
1: 0
2: 0
3: 12
4: 176
Right 1077522906 11:3046757-3046779 CCCACAGCCACAGGAGGAGCTGG 0: 1
1: 1
2: 6
3: 89
4: 1199
1077522899_1077522910 13 Left 1077522899 11:3046733-3046755 CCCCCACATGAAGGTGGAGGAGT 0: 1
1: 0
2: 0
3: 12
4: 176
Right 1077522910 11:3046769-3046791 GGAGGAGCTGGGCCACCCAAAGG 0: 1
1: 0
2: 4
3: 46
4: 286
1077522899_1077522903 -8 Left 1077522899 11:3046733-3046755 CCCCCACATGAAGGTGGAGGAGT 0: 1
1: 0
2: 0
3: 12
4: 176
Right 1077522903 11:3046748-3046770 GGAGGAGTGCCCACAGCCACAGG 0: 1
1: 0
2: 6
3: 49
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077522899 Original CRISPR ACTCCTCCACCTTCATGTGG GGG (reversed) Intronic
900934240 1:5755333-5755355 TCTGCTCCAGCTCCATGTGGTGG - Intergenic
901196650 1:7443993-7444015 ACTCCTCCAGCTTCCTCTGGGGG - Intronic
902288736 1:15423158-15423180 ACCCCTCCAGCTCCAGGTGGAGG + Intronic
902527567 1:17069059-17069081 AGCCCTTCACCTTCAAGTGGTGG - Exonic
904785604 1:32980316-32980338 TCTCCTCCACCTTCATGATCTGG - Intergenic
906373512 1:45274568-45274590 ACTCCTGCAGCTTCATATGTGGG - Intronic
907065831 1:51482205-51482227 ACTCTTACACATTCATATGGAGG - Intronic
908541781 1:65129170-65129192 ACACCTCCTTCTTCATATGGTGG + Intergenic
911847243 1:102769825-102769847 ACTATTCAACCTTCCTGTGGTGG + Intergenic
914050776 1:144128263-144128285 CTTCCTCCACCTTCTTGAGGAGG - Intergenic
914128405 1:144837181-144837203 CTTCCTCCACCTTCTTGAGGAGG + Intergenic
915092713 1:153437793-153437815 ACTCCTCTAGGTTCAAGTGGAGG - Intronic
915247573 1:154567639-154567661 ACTCCTCCACCGTGCCGTGGAGG + Intergenic
916619288 1:166478386-166478408 AATCCTCCACCTGCATGGAGAGG + Intergenic
922212378 1:223495944-223495966 ACTCCTCCAGCCTCAGGTAGGGG + Intergenic
922347627 1:224709491-224709513 ACTCCAGCACCTTCAAGTGTAGG + Intronic
1063591713 10:7401401-7401423 ACTCCTCCAGCTCCGTGTGCTGG - Intronic
1064886704 10:20120702-20120724 AATCCTCGAGCTTCATGTGTAGG + Intronic
1067941307 10:50659412-50659434 CCTCCTCCTCCTGCATGTGGGGG - Intergenic
1070862527 10:79684283-79684305 CCTCCTCCTCCTGCATGTGGGGG - Intergenic
1070862546 10:79684374-79684396 CCTCCTCCTCCTGCATGTGGGGG - Intergenic
1070957384 10:80473460-80473482 TCTCCTGCACCTGCATGTGGAGG + Intronic
1072267033 10:93740790-93740812 ACTCCTCCTTGTTCAGGTGGAGG - Intergenic
1073709189 10:106019162-106019184 AATCCTCCAGCTTGATGTGTAGG + Intergenic
1074306059 10:112279658-112279680 CCCCCTCCACCTTCATGTGAGGG + Intergenic
1075690945 10:124393835-124393857 ACTCCTCCAACTGTATGTGTTGG + Intergenic
1075726824 10:124614969-124614991 TATCGTCCACCTTCATGTGGTGG - Intronic
1077522899 11:3046733-3046755 ACTCCTCCACCTTCATGTGGGGG - Intronic
1078530042 11:12130281-12130303 CCTCCTCCACCTTCAGTTGCAGG - Intronic
1080194680 11:29595337-29595359 ACATGTCCATCTTCATGTGGTGG - Intergenic
1081995315 11:47359906-47359928 TCTGCTCCAGCTCCATGTGGCGG + Exonic
1085517612 11:77120700-77120722 TCTCCTCCACCTGCAGGAGGCGG - Exonic
1089751698 11:120655978-120656000 TCTCCTCCACCTGCATGCTGTGG - Intronic
1091687167 12:2571633-2571655 ACTACTACTCCTTCTTGTGGAGG - Intronic
1097377823 12:58859867-58859889 ACACGTCCTTCTTCATGTGGGGG + Intergenic
1099218141 12:79878658-79878680 ACACCTCCTCCTTCACATGGCGG + Intronic
1099256301 12:80317855-80317877 TCAGCTCCACCTTGATGTGGGGG + Intronic
1103999615 12:124852204-124852226 GCTACTCCACCTTCATGCTGGGG + Intronic
1105865707 13:24457482-24457504 ACTCCTCCACCACTATGTAGTGG + Intronic
1107414813 13:40190560-40190582 GCTCCTCCAGCTTCTTTTGGAGG - Intergenic
1108120843 13:47184440-47184462 ACTCCTCCTCCTCATTGTGGTGG - Intergenic
1108692519 13:52872049-52872071 ACTGCACCACCTTCATTTGGTGG + Intergenic
1109709373 13:66142864-66142886 AATCCTCCAGCTTGATGTGTAGG + Intergenic
1112187816 13:97144766-97144788 CATCCTCCGCCGTCATGTGGTGG - Intergenic
1112403997 13:99101947-99101969 ACACATCCTTCTTCATGTGGCGG + Intergenic
1112430119 13:99343531-99343553 ACTCCTCCACTTTCATAGGATGG + Intronic
1116265838 14:42688360-42688382 ACACATCCTTCTTCATGTGGAGG + Intergenic
1116385950 14:44330079-44330101 AAGCCACCACCTTCCTGTGGTGG + Intergenic
1117502349 14:56365771-56365793 ACTCCTGCACAGCCATGTGGTGG + Intergenic
1119387519 14:74267048-74267070 GTTCCTCCACGTTCATGTGTTGG - Intergenic
1120611028 14:86641631-86641653 TCTCCTCCACTTACATATGGTGG + Intergenic
1202840968 14_GL000009v2_random:120857-120879 ACTCCAGCACAGTCATGTGGTGG - Intergenic
1202910353 14_GL000194v1_random:111085-111107 ACTCCAGCACAGTCATGTGGTGG - Intergenic
1124254130 15:28127318-28127340 GCTCCTCCCCTTGCATGTGGGGG - Intronic
1125731332 15:41894187-41894209 ACTTCTCCAACTCCAGGTGGGGG + Intergenic
1127863058 15:63010459-63010481 ACTCCTCCACCTTCCTCAGTTGG - Intergenic
1132666465 16:1083317-1083339 ACACCTCCTCCTGCCTGTGGGGG - Intergenic
1138579142 16:57928381-57928403 ATTCCTCCAGCTCCATGTGCCGG - Intronic
1141389686 16:83654310-83654332 CCTCCTGCACCCTCACGTGGTGG + Intronic
1144828403 17:18119223-18119245 ACTCCTCGGCCTTCTTGAGGAGG - Exonic
1146793573 17:35766294-35766316 CCACCCCCACCTCCATGTGGTGG + Intronic
1148215750 17:45833285-45833307 ACTCCTCTACCTAGAGGTGGGGG + Intronic
1148599184 17:48881163-48881185 TCTCCTCCACCTTCATGATCTGG - Intergenic
1149895622 17:60426422-60426444 AGTCCTTCATCTTTATGTGGAGG + Intronic
1150604357 17:66678228-66678250 CCTCTTCCACCTTCCAGTGGTGG - Intronic
1158497593 18:57970443-57970465 CCTCCTCCACCTGGATCTGGTGG - Intergenic
1159389079 18:67765187-67765209 ACTCCACCACAGTCACGTGGTGG + Intergenic
1161480953 19:4510449-4510471 GCTCCTCCGCATTCATGGGGTGG + Exonic
1162131301 19:8527597-8527619 ACTCATACACCTTCACCTGGAGG - Intronic
1163100046 19:15090036-15090058 CTGCCTCCATCTTCATGTGGCGG - Intergenic
1164808578 19:31138357-31138379 ACTCCTGCACCCTCCTCTGGAGG + Intergenic
1166710847 19:44936196-44936218 ACTCCTCAACCAGCAAGTGGTGG - Intergenic
1168683625 19:58334856-58334878 CCTCCTCCACCTTCACTTGAAGG - Exonic
1202690184 1_KI270712v1_random:80902-80924 CTTCCTCCACCTTCTTGAGGAGG - Intergenic
928065907 2:28164314-28164336 ACTCCTCTAACTCCACGTGGGGG - Intronic
931096253 2:58943873-58943895 ACACATCCTTCTTCATGTGGTGG - Intergenic
932209942 2:69919257-69919279 TCTCCTCCACCTACAAGGGGTGG + Intronic
933283787 2:80361783-80361805 TCTCTTCCACCTTCATGGAGAGG - Intronic
939905675 2:147910818-147910840 ACTGCTTCACCTTGATGTGCTGG + Intronic
942979469 2:182061995-182062017 ACTCCTACACATGTATGTGGAGG - Intronic
944587548 2:201185918-201185940 ACTTCTCCAGCTTCTTGTTGGGG - Exonic
946108841 2:217396394-217396416 GTTCCTCCAACTTCATGTAGTGG - Intronic
947531091 2:230909015-230909037 CCTCCTCCACCCTCCTATGGTGG + Exonic
948586651 2:239024129-239024151 ACGCATCCTGCTTCATGTGGTGG + Intergenic
1176629709 21:9125786-9125808 ACTCCAGCACAGTCATGTGGTGG - Intergenic
1177270545 21:18843524-18843546 TCTCCTCCACTTTCAAGTGAAGG - Intergenic
1178885903 21:36484536-36484558 CCTCCTCCAGCTTCTGGTGGTGG + Intronic
1180420714 22:12811948-12811970 ACTCCAGCGCATTCATGTGGTGG - Intergenic
1181037546 22:20177199-20177221 AGCCCTCCACCTTTATGTGGCGG + Intergenic
1184164003 22:42716806-42716828 GCTCCTTCCCCTTCAGGTGGGGG - Intronic
1184379421 22:44135775-44135797 CCTCCTCCAGCTTCTGGTGGTGG + Intronic
1184687062 22:46101014-46101036 TCCCCTCGACCTGCATGTGGAGG - Intronic
1185132789 22:49049454-49049476 ACACATCCTTCTTCATGTGGCGG + Intergenic
1185250365 22:49798671-49798693 CCTGCTCCACCTTCACCTGGGGG + Exonic
949896390 3:8769837-8769859 ACACCTCCAGCTTGATGTAGCGG + Intronic
950533776 3:13568097-13568119 AGTCCTCCAGCTTCCTGAGGTGG + Intronic
950664976 3:14489863-14489885 ACTCCCCCACCGTCAGGTGCAGG + Exonic
952538859 3:34345044-34345066 ACACATCCTTCTTCATGTGGCGG - Intergenic
952951208 3:38526933-38526955 TCTCCTCCACCTTCATGATCTGG + Intronic
953076835 3:39579337-39579359 AATCCTCAAGCTTGATGTGGAGG + Intergenic
953505865 3:43485109-43485131 TCACCTCCACCTTCATCTGGTGG + Intronic
954680731 3:52344610-52344632 GCTCCTCCTCCTTCTTGGGGAGG - Exonic
956908757 3:73795128-73795150 ACTCCTCTACCCTCATTGGGAGG + Intergenic
957734530 3:84188934-84188956 AATCCTCCAGCTTGATGTGTAGG + Intergenic
958625704 3:96619671-96619693 TCTCCTCCACCTTCATGATCTGG - Intergenic
958664108 3:97111788-97111810 ACTCTTCCACATTCATTTGACGG + Intronic
959626843 3:108462250-108462272 ACTTCTGCACCATCATGTGATGG - Intronic
960729244 3:120707094-120707116 ATTCCTCCATCTTCAAGAGGTGG + Intronic
961464045 3:127070799-127070821 AATCCTCCACCTCCACGTAGTGG + Intergenic
963468898 3:145714572-145714594 AATCCTCCAGCTTGATGTGTAGG - Intergenic
963549296 3:146700321-146700343 ACACTTCCTTCTTCATGTGGTGG + Intergenic
967199828 3:187063203-187063225 GCTCCACCACCATCATGTTGTGG - Intronic
968761375 4:2444155-2444177 ACTCCTACTCCTTCCTTTGGAGG - Intronic
969121670 4:4915554-4915576 AGCCCTCCTCCTTCATCTGGCGG - Intergenic
969785458 4:9453871-9453893 ACTCCTCCACCATCTTCGGGAGG + Intergenic
969843451 4:9900762-9900784 ACTCATCCTTCTTCATGTGGTGG + Intronic
971200425 4:24505182-24505204 AATCCTCCAGCTTGATGTGTAGG - Intergenic
971456666 4:26851530-26851552 ACACCTCAAACTTCAGGTGGAGG + Intergenic
971927222 4:33027516-33027538 ACTCCTCCAAATACAAGTGGAGG + Intergenic
972266100 4:37461527-37461549 GCTCCTCCACCCTCATGTAAAGG - Intronic
973973246 4:56236277-56236299 CCTCTTCCAGCTTCAGGTGGTGG - Intronic
978375967 4:108076069-108076091 GCTACTCCATCTGCATGTGGGGG + Intronic
981121689 4:141058522-141058544 AATATTCCACCTTCATGTAGTGG + Intronic
982185939 4:152798953-152798975 TCTCCCTGACCTTCATGTGGTGG - Intronic
985556450 5:560934-560956 CGTCCTGCACCTTCCTGTGGTGG + Intergenic
985582641 5:706970-706992 AATCCTCCAGCTTGATGTGTAGG - Intergenic
986323735 5:6655665-6655687 ACCCCTCCTGGTTCATGTGGTGG + Intronic
986830549 5:11572472-11572494 ACTACTCAACCTTCTTGGGGAGG + Intronic
991352714 5:65735168-65735190 ACACCTCCTTATTCATGTGGTGG - Intronic
992180932 5:74197697-74197719 ACTCACCCAGCTTCATGGGGAGG - Intergenic
996657704 5:125961108-125961130 TTTCCTTCAACTTCATGTGGAGG + Intergenic
996872110 5:128203154-128203176 ACTGCTCCACATTGATGGGGAGG - Intergenic
999271755 5:150300844-150300866 ACTCCTCCACCCTCTTCTGCAGG + Intronic
1000459419 5:161495997-161496019 ACACCTCCACCTTCCCGTGTGGG - Intronic
1000607290 5:163338582-163338604 ACTCCTCAAGCTTAATGTGTAGG - Intergenic
1001290397 5:170453597-170453619 TCTCATCTACCTTCAAGTGGAGG - Intronic
1004134147 6:12950439-12950461 ACCACTCCACCATCAAGTGGTGG - Intronic
1006401217 6:33818680-33818702 TCTCCTTCACCTTCAGGTGTTGG - Intergenic
1007299178 6:40853406-40853428 ACTCCCCTACCTTCCTGTGTAGG + Intergenic
1009893497 6:69718602-69718624 ACACGTCCTTCTTCATGTGGCGG + Intronic
1010651158 6:78456632-78456654 ACACCTCCTTCTTCACGTGGAGG + Intergenic
1012316104 6:97783758-97783780 AATCCTCCAGCTTGATGTGTAGG - Intergenic
1014188592 6:118465096-118465118 AATCCTACTCCTTCATGTGAAGG + Exonic
1014497928 6:122150561-122150583 ACTGCTCCACCTTTTTTTGGTGG + Intergenic
1017389799 6:153925666-153925688 AATCCTCCAGCTTGATGTGTAGG - Intergenic
1020329637 7:7004443-7004465 AGTCCTTTTCCTTCATGTGGAGG + Intergenic
1021637679 7:22707795-22707817 AATCCTCCAGCTTGATGTGTAGG - Intergenic
1021810942 7:24400448-24400470 AATCCTCCAGCTTGATGTGTAGG - Intergenic
1022033607 7:26514359-26514381 TCTCCTCCCCCTTCATGTCTTGG + Intergenic
1023740282 7:43274497-43274519 TCTCCTCCACCTTCATGATCTGG - Intronic
1027632343 7:80622118-80622140 ACTTTCCCACCTTCAGGTGGGGG + Intronic
1031108075 7:117570157-117570179 ACACCTTCACCTTCATAAGGTGG - Intronic
1031631077 7:124043719-124043741 ACTCCTTAACCTTCAGTTGGAGG + Intergenic
1031727652 7:125260440-125260462 AATCCTCCAGCTTGATGTGTAGG + Intergenic
1033675655 7:143538762-143538784 AATCCTCCAGCTTGATGTGTAGG + Intergenic
1033696179 7:143790682-143790704 AATCCTCCAGCTTGATGTGTAGG - Intergenic
1034100855 7:148449234-148449256 ACCCCTTCACCTTCATGGGAAGG + Intergenic
1034427944 7:151024299-151024321 CCTCCTCCTCCTTCATGCCGGGG - Exonic
1038286106 8:26207556-26207578 ACTCCTTCACTTTTATGTGAAGG + Intergenic
1045573869 8:103397636-103397658 ACACCTCCACCCTTATCTGGAGG + Intergenic
1047760476 8:127950490-127950512 ACTCCTCCACCTTCAGGTTCAGG - Intergenic
1048190270 8:132282004-132282026 CCAACTCCTCCTTCATGTGGTGG + Intronic
1049056244 8:140239505-140239527 ACTCCACCACCCTCATCTCGCGG - Intronic
1049247550 8:141570932-141570954 ACACGTCCTCCTTCAAGTGGTGG + Intergenic
1049343831 8:142128041-142128063 GCTGCTCCTCCTTCCTGTGGGGG + Intergenic
1049870646 8:144972833-144972855 ACTCCTGCACATACATGTTGGGG - Intergenic
1053461331 9:38273577-38273599 ACTGCTACAACTTCCTGTGGTGG - Intergenic
1056054535 9:82807219-82807241 ACACGTCCTTCTTCATGTGGTGG - Intergenic
1057431244 9:94996314-94996336 ACTCCACCCCCCACATGTGGTGG + Intronic
1058114193 9:101066442-101066464 CATGCTCCACCTTCATGGGGTGG + Intronic
1060734667 9:126059336-126059358 GCTCTTCCTCCTGCATGTGGAGG - Intergenic
1062512474 9:136914361-136914383 TCTCCTTCAGCTTCCTGTGGTGG + Intronic
1203752543 Un_GL000218v1:93467-93489 ACTCCAGCACAGTCATGTGGTGG - Intergenic
1203555565 Un_KI270743v1:204471-204493 ACTCCAGCGCATTCATGTGGTGG - Intergenic
1188945469 X:36295285-36295307 ATTCCTCCACTTTCATGAGTAGG - Intronic
1189197674 X:39165843-39165865 ATTGCTCCACCTTCATGTTCAGG - Intergenic
1192787605 X:74350415-74350437 ACTCCTACCCCTTCTTTTGGTGG + Intergenic
1194109824 X:89819534-89819556 ACTCCAGCACAGTCATGTGGGGG - Intergenic
1194796671 X:98219630-98219652 CCTCCTCCATCTACAGGTGGAGG + Intergenic
1196080382 X:111624347-111624369 TCTCCTCCACCTTCATGATCTGG + Intergenic
1196226914 X:113178328-113178350 AATCCTCCAGCTTGATGTGTAGG + Intergenic
1198877307 X:141241552-141241574 ATTCCTCCTCCTCCATTTGGAGG + Exonic
1198907989 X:141583773-141583795 ATTCCTCCTCCTCCATTTGGAGG + Exonic
1198908802 X:141590651-141590673 ATTCCTCCTCCTCCATTTGGAGG - Exonic
1198918269 X:141697500-141697522 ATTCCTCCTCCTCCATTTGGAGG + Exonic
1200057239 X:153468138-153468160 ACGCCTCCTCCTTCCTCTGGGGG + Intronic
1200462491 Y:3474273-3474295 ACTCCAGCACAGTCATGTGGTGG - Intergenic
1200952482 Y:8913257-8913279 AGTCCTCCACCCTAATATGGAGG + Intergenic
1201058941 Y:10025325-10025347 AGTCCTCCACCCTAATATGGAGG - Intergenic