ID: 1077522900

View in Genome Browser
Species Human (GRCh38)
Location 11:3046734-3046756
Sequence CACTCCTCCACCTTCATGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 164}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077522900_1077522908 1 Left 1077522900 11:3046734-3046756 CCCCACATGAAGGTGGAGGAGTG 0: 1
1: 0
2: 0
3: 11
4: 164
Right 1077522908 11:3046758-3046780 CCACAGCCACAGGAGGAGCTGGG 0: 1
1: 0
2: 10
3: 591
4: 16089
1077522900_1077522903 -9 Left 1077522900 11:3046734-3046756 CCCCACATGAAGGTGGAGGAGTG 0: 1
1: 0
2: 0
3: 11
4: 164
Right 1077522903 11:3046748-3046770 GGAGGAGTGCCCACAGCCACAGG 0: 1
1: 0
2: 6
3: 49
4: 343
1077522900_1077522906 0 Left 1077522900 11:3046734-3046756 CCCCACATGAAGGTGGAGGAGTG 0: 1
1: 0
2: 0
3: 11
4: 164
Right 1077522906 11:3046757-3046779 CCCACAGCCACAGGAGGAGCTGG 0: 1
1: 1
2: 6
3: 89
4: 1199
1077522900_1077522904 -6 Left 1077522900 11:3046734-3046756 CCCCACATGAAGGTGGAGGAGTG 0: 1
1: 0
2: 0
3: 11
4: 164
Right 1077522904 11:3046751-3046773 GGAGTGCCCACAGCCACAGGAGG 0: 1
1: 0
2: 2
3: 26
4: 231
1077522900_1077522910 12 Left 1077522900 11:3046734-3046756 CCCCACATGAAGGTGGAGGAGTG 0: 1
1: 0
2: 0
3: 11
4: 164
Right 1077522910 11:3046769-3046791 GGAGGAGCTGGGCCACCCAAAGG 0: 1
1: 0
2: 4
3: 46
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077522900 Original CRISPR CACTCCTCCACCTTCATGTG GGG (reversed) Intronic
901196651 1:7443994-7444016 AACTCCTCCAGCTTCCTCTGGGG - Intronic
903028008 1:20443285-20443307 CTCTCCTCCACCCCCATCTGGGG + Intergenic
906373513 1:45274569-45274591 GACTCCTGCAGCTTCATATGTGG - Intronic
914734995 1:150407579-150407601 TACTCCTCCACCACTATGTGAGG - Intronic
918520480 1:185409523-185409545 CCCTCCTCCACCGGCAGGTGTGG + Intergenic
918578496 1:186095471-186095493 GACTTCTCCAGCTTCATTTGAGG - Exonic
920910369 1:210210672-210210694 CATTCCTCCTCCTGCGTGTGGGG - Intergenic
922472698 1:225886776-225886798 CACTTCTGCACCCTCATGTTGGG + Exonic
922480511 1:225937490-225937512 CACTTCTGCACCCTCATGTTGGG + Exonic
923220781 1:231891141-231891163 CAATTCTCCTCCTTCAAGTGTGG - Intronic
924919539 1:248613152-248613174 CATTTCTCCATATTCATGTGGGG + Intergenic
924931585 1:248737201-248737223 CAGTGCTCCACGTTGATGTGAGG - Intronic
1063133624 10:3198494-3198516 CTCTCCCCCACCCCCATGTGAGG - Intergenic
1063899794 10:10720490-10720512 CATTTCTCCACCTTTATCTGTGG + Intergenic
1065524871 10:26609995-26610017 CACTCTTCCACCGTCATTGGAGG + Intergenic
1066560971 10:36669254-36669276 CAATCCACCACCATCCTGTGTGG - Intergenic
1067941309 10:50659413-50659435 GCCTCCTCCTCCTGCATGTGGGG - Intergenic
1070827671 10:79400718-79400740 CACTCCTGCCCCTGCAGGTGTGG + Intronic
1070862529 10:79684284-79684306 GCCTCCTCCTCCTGCATGTGGGG - Intergenic
1070862548 10:79684375-79684397 GCCTCCTCCTCCTGCATGTGGGG - Intergenic
1072795684 10:98352745-98352767 CACACCCCCACCATCATGTCTGG - Intergenic
1073096801 10:100984821-100984843 CCCTCCTCTCCCTTCCTGTGTGG + Exonic
1073426863 10:103460210-103460232 CACTCCTCCACCTACAAGCTGGG - Intergenic
1074306057 10:112279657-112279679 TCCCCCTCCACCTTCATGTGAGG + Intergenic
1075095171 10:119466456-119466478 CAAACCTCCTCCTTCCTGTGAGG + Intergenic
1077522900 11:3046734-3046756 CACTCCTCCACCTTCATGTGGGG - Intronic
1078701899 11:13693396-13693418 GCCTCCTCCACCTTCGTTTGTGG + Intronic
1082944737 11:58746113-58746135 CTTTCCTCCCCCTACATGTGGGG - Intergenic
1083164002 11:60872493-60872515 CACTCCTCCACACTCTGGTGGGG - Intronic
1085059068 11:73427921-73427943 CAGTCCTACTCCTTCCTGTGAGG + Intronic
1085522902 11:77148462-77148484 CTCTCCTCCACCTTCAAATGGGG + Intronic
1087762868 11:102121030-102121052 CACTCTTATTCCTTCATGTGCGG + Intronic
1089660356 11:119981559-119981581 CTCTCCTCCACATTCCTGGGAGG + Intergenic
1093020063 12:14195033-14195055 CAGCCCTCCACCTTCATTTCCGG - Intergenic
1095719880 12:45388738-45388760 CACTGCTCCACCTTCTGGTTGGG + Intronic
1096866849 12:54569498-54569520 CACTCCCAGACCTTCATATGTGG + Intronic
1098850922 12:75594779-75594801 CTTTCCTCCACCTTCAAGTAGGG + Intergenic
1099256300 12:80317854-80317876 CTCAGCTCCACCTTGATGTGGGG + Intronic
1100155701 12:91797948-91797970 CACTACTGCATCTTCATGTTTGG + Intergenic
1104341870 12:127957806-127957828 CACTCTTCAACCTGCATGGGTGG - Intergenic
1106402041 13:29440752-29440774 CACTCCTCCTCCATCTAGTGTGG + Intronic
1107043414 13:35972166-35972188 CTCTCCTCCTCCTTCCTCTGAGG + Intronic
1113966364 13:114155713-114155735 CACTTCTCCACCCTCATGCCCGG - Intergenic
1116672006 14:47854756-47854778 CACTCCACCTCCTTCATCTCTGG + Intergenic
1122169047 14:99856070-99856092 CACCCCTCCACGTTTCTGTGAGG + Intronic
1124163135 15:27293177-27293199 CACTCATCCACCATCATCTTTGG - Intronic
1124641765 15:31400369-31400391 CACGCCACCCCCTCCATGTGGGG - Intronic
1128329502 15:66746318-66746340 CTCTCCTCCTCCCTCCTGTGGGG + Intronic
1128798925 15:70484725-70484747 CACTCCTCCTCTGTCAAGTGAGG + Intergenic
1130963119 15:88678170-88678192 CTCTCCTCCAGCATCATCTGTGG + Intergenic
1131648507 15:94373070-94373092 CACTCCTCCTCCAGGATGTGTGG - Intronic
1132594541 16:742409-742431 CACTCCTGCACCTGCCTGTGGGG + Intronic
1132733953 16:1376392-1376414 CACTCCTCCTCCCTCCTCTGAGG + Intronic
1133873054 16:9707638-9707660 CACTCCGCCATCGTAATGTGGGG - Intergenic
1133944023 16:10333700-10333722 CACTCCTTCAACTTTTTGTGGGG + Intronic
1134066717 16:11233114-11233136 CCCTCCTCCCTCTTCATGGGGGG + Intergenic
1134742160 16:16557518-16557540 CACCCCTTCAGCTTCATCTGGGG + Intergenic
1134925402 16:18154938-18154960 CACCCCTTCAGCTTCATCTGGGG - Intergenic
1137717846 16:50609810-50609832 GACTCCTCCCCCTTGATCTGGGG - Intronic
1141137261 16:81474461-81474483 CACTACTTCTGCTTCATGTGAGG + Intronic
1141146310 16:81532689-81532711 CACACCTCCACCTTCCTTGGAGG - Intronic
1141772265 16:86096494-86096516 CACTCCGCCACCTCCCTGGGTGG + Intergenic
1141885909 16:86892019-86892041 CACTCCCCCACCTTCAGGGCGGG + Intergenic
1145905734 17:28515158-28515180 CCCTCCTCTGCCTTTATGTGGGG - Intronic
1149645791 17:58240633-58240655 CCCTCCTCCACTTTCCAGTGAGG + Intronic
1150324512 17:64246008-64246030 CATACGCCCACCTTCATGTGAGG + Intronic
1151540779 17:74763641-74763663 CCCTCCTCCTCCTTCATGGGAGG + Intronic
1152924707 17:83081506-83081528 CACCCCTCCACCTCCAGGGGCGG + Intronic
1153373913 18:4354295-4354317 CCTTCCTCCACCTTGCTGTGTGG + Intronic
1153907935 18:9679365-9679387 CACTCCTCCAGCTTCTGGGGCGG - Intergenic
1154152478 18:11917401-11917423 CACTCCTCCCGATTCACGTGTGG + Intergenic
1157730541 18:50000668-50000690 CACTCCTCAGCCTTCATGATAGG - Intronic
1158670658 18:59470821-59470843 CACCCGTTCACCTTCATATGTGG - Intronic
1160785637 19:899176-899198 CACTCCTCCATCTGCATCTTCGG - Intronic
1161614989 19:5265133-5265155 CGCTCCACCACCTTCAACTGTGG + Exonic
1162845053 19:13386027-13386049 CACTCCTCCAGCTGCTCGTGAGG + Intronic
1164464832 19:28478702-28478724 CACTCCTCTACATTCACCTGGGG - Intergenic
1164536155 19:29087839-29087861 GTCTCCTTCTCCTTCATGTGGGG - Intergenic
1168314523 19:55478717-55478739 CAGGCCTCCACCTTGATCTGAGG - Intronic
1168647017 19:58065975-58065997 CCCTCCTCCTCCTTCATGGCAGG - Intronic
925019623 2:558261-558283 CATTCCTCCAGCTTCCTGTGAGG + Intergenic
925065871 2:928527-928549 CAGGCCTCCTCCTTCATCTGTGG - Intergenic
925065883 2:928594-928616 CAGTCCTCCTCCTTCACTTGTGG - Intergenic
925065908 2:928728-928750 CAGGCCTCCTCCTTCATCTGTGG - Intergenic
925065920 2:928795-928817 CAGGCCTCCTCCTTCATCTGTGG - Intergenic
926587661 2:14706177-14706199 TTGGCCTCCACCTTCATGTGGGG + Intergenic
926854901 2:17244713-17244735 CCCACTCCCACCTTCATGTGCGG - Intergenic
928065908 2:28164315-28164337 CACTCCTCTAACTCCACGTGGGG - Intronic
936107319 2:109636048-109636070 CTCTCCTCTTCCTCCATGTGAGG + Intergenic
937222497 2:120349839-120349861 CACTCCTCCACAATCATGTTGGG - Exonic
943865194 2:192919228-192919250 CACTTCTCCACTTTCCTGGGGGG + Intergenic
944915357 2:204354824-204354846 CACACCACCACCTTCCTGTAGGG + Intergenic
947907971 2:233779563-233779585 CGCAGCTCCAGCTTCATGTGTGG - Intronic
948354668 2:237368587-237368609 CACTCCTGCACCTCCAGGGGTGG - Exonic
1169726291 20:8736660-8736682 CTCTCTTCTCCCTTCATGTGAGG - Intronic
1170099301 20:12681102-12681124 CACTCCTCCATCAAGATGTGGGG - Intergenic
1171199341 20:23228454-23228476 CACTCCCCCAACACCATGTGAGG + Intergenic
1172009721 20:31839460-31839482 CACTCCTAAACCTTCATGGAGGG + Intergenic
1172186568 20:33034752-33034774 CTGTCCTCCAGCTTCATGGGAGG + Exonic
1175329741 20:58155363-58155385 CACTCCCCCAGCTTCACCTGAGG + Intronic
1175661372 20:60815910-60815932 CCCACCACCACCTTCATTTGAGG + Intergenic
1175763773 20:61579094-61579116 CCATCCTCCACCCTCAGGTGTGG - Intronic
1182155988 22:28073436-28073458 CACTCCTCCATCTTCTTCTGTGG - Intronic
1184152181 22:42645689-42645711 GACTCCTCCCACTTCAGGTGAGG + Intronic
1184357415 22:43991795-43991817 CACTCTTCCTCCTCCAAGTGAGG - Intronic
1184864049 22:47192742-47192764 CACTCCTACCCCTGGATGTGTGG + Intergenic
952040106 3:29251341-29251363 CACCCCTCCATCTTCAGCTGAGG + Intergenic
953524189 3:43674113-43674135 CACATGTCTACCTTCATGTGTGG + Intronic
953896552 3:46807630-46807652 CCATCCTCCACCTCCAGGTGTGG - Intronic
954387018 3:50249411-50249433 CACTCCTCCACCTGCCAATGAGG - Intronic
955043718 3:55340172-55340194 AACTCCCCCACCTCCCTGTGTGG - Intergenic
955202688 3:56865118-56865140 CACTCCTCCACTTCCCTGTGGGG + Intronic
960174289 3:114498680-114498702 CACTCCCCCAGCCTTATGTGTGG + Intronic
960616360 3:119599492-119599514 CACTCCTCAACCTTCAAATCAGG - Intronic
961556336 3:127698864-127698886 CACACCGCCACCTTCCTGTTTGG + Intronic
966668050 3:182495136-182495158 CACTCCTAGAGCTGCATGTGAGG + Intergenic
967296050 3:187966031-187966053 CACTCCTTCACATTCATGGCAGG + Intergenic
967714673 3:192748840-192748862 CAAAGCTCCACTTTCATGTGCGG - Intronic
968732064 4:2273870-2273892 CCCTCCTCCTCCTGCCTGTGTGG + Intronic
971372678 4:26030805-26030827 CAGTCCTGCACCTTCAGGTAAGG + Intergenic
976272849 4:83248186-83248208 AACTGCTCTACCCTCATGTGAGG + Intergenic
979393907 4:120162705-120162727 CTCTCCTCCTCCTCCATGGGAGG + Intergenic
980387737 4:132108218-132108240 CACTCCTCCTCCTTCCTGAATGG + Intergenic
985318246 4:188681126-188681148 CACACCTCCTTCTTCATTTGGGG + Intergenic
987372646 5:17207476-17207498 CACTTCCCCACCCTCAGGTGGGG + Intronic
989154278 5:38329476-38329498 CACACCTCCAACTTCGTGGGTGG + Intronic
991494826 5:67216540-67216562 CACCTCTCCCACTTCATGTGTGG - Intergenic
996831500 5:127745173-127745195 GACTGATCCAACTTCATGTGCGG - Intergenic
1000178532 5:158783748-158783770 CATTCAACCACCTTCATGTCTGG - Intronic
1000459420 5:161495998-161496020 AACACCTCCACCTTCCCGTGTGG - Intronic
1002051200 5:176572596-176572618 CACTCCTCCCCCTTGCTGCGGGG - Intronic
1004723719 6:18291177-18291199 CTCTCCTCCTCCTTCAGCTGTGG - Intergenic
1006788349 6:36682776-36682798 CTCTCCTCCCCCTTCAGGAGAGG - Intronic
1007076440 6:39070000-39070022 CACTCCTTCCCCATCATGTGAGG - Intronic
1012924992 6:105258726-105258748 CACTTCTCCACTTTCTTTTGTGG + Intergenic
1016823121 6:148364342-148364364 CACTGCTCCACTTTCCTTTGGGG + Intronic
1017807176 6:157955829-157955851 CTATCCTCCACATGCATGTGTGG - Intergenic
1019434910 7:1017601-1017623 CCCTCCTGCACCTTCTTCTGGGG + Intronic
1021461177 7:20888734-20888756 CCCTCCTCCACCCCCATCTGTGG + Intergenic
1021564369 7:22002286-22002308 CACTCCCCCTCTTCCATGTGAGG - Intergenic
1024289088 7:47787468-47787490 CAAGCCTCCACCATCATTTGAGG + Intronic
1026275486 7:68872254-68872276 CACACCTCCTCCTGCATGTGGGG + Intergenic
1026385928 7:69847759-69847781 CTGTCCTCAACCTTCATCTGTGG - Intronic
1027740841 7:82002258-82002280 CACCCCTTCTCCTCCATGTGAGG + Intronic
1028842104 7:95439850-95439872 AACTCCCCAACCTCCATGTGAGG + Intergenic
1029309348 7:99647311-99647333 CTCTTGTCCACCTTAATGTGTGG + Intergenic
1029315014 7:99703949-99703971 CTCTTCTCTACCTTAATGTGTGG + Intronic
1029320696 7:99756837-99756859 CTCTTCTCTACCTTAATGTGTGG + Intergenic
1029512748 7:101006660-101006682 ACCTCCTCCACCTGCAAGTGAGG - Intronic
1031663069 7:124451384-124451406 CACTCCTCCACCTACTTCTTTGG - Intergenic
1032075333 7:128833301-128833323 CTCTCCTCCCCCTCCATTTGAGG + Intronic
1033160704 7:138993881-138993903 AACTCAGCCACCATCATGTGTGG + Intergenic
1034383298 7:150717944-150717966 CTCTGCCCCTCCTTCATGTGTGG + Intronic
1034566043 7:151916669-151916691 CAATCCTCCATCTTCACATGGGG + Intergenic
1036732168 8:11275446-11275468 CACTACTCCACTTTCTTGTAAGG + Intergenic
1038207154 8:25477373-25477395 CCCCCCTCGACCTTCATGTTCGG + Intronic
1040937915 8:52800232-52800254 CAGACCTCCACCTTTTTGTGAGG + Intergenic
1041524169 8:58787315-58787337 CAAGCCTCCAACTCCATGTGCGG - Intergenic
1044093427 8:88030848-88030870 CACAGCTCCCCTTTCATGTGTGG + Intergenic
1047061774 8:121235386-121235408 CCCCCCTCCCCCTTCATTTGGGG - Intergenic
1047343506 8:124005323-124005345 TACTTCTCCACCTTCATTTCTGG + Intronic
1047818978 8:128497308-128497330 CACTCCACCAACTTGCTGTGAGG + Intergenic
1049328808 8:142038865-142038887 CACTCCTCCACTTACCTGAGTGG - Intergenic
1049870647 8:144972834-144972856 CACTCCTGCACATACATGTTGGG - Intergenic
1051515557 9:17926498-17926520 CTCTCCTCCTCCTTCCTGGGTGG - Intergenic
1054793276 9:69275733-69275755 CTCTGCTCCACCTTGATGTCTGG + Intergenic
1058172366 9:101697765-101697787 CACTCCTGCCCCTTAATTTGTGG - Intronic
1058335129 9:103818575-103818597 CTCTCCTCCACCTTCACATCAGG - Intergenic
1059575359 9:115482434-115482456 CACTTCTTCATCTCCATGTGTGG + Intergenic
1060825360 9:126684589-126684611 CCCTACTCCATCTTCAGGTGTGG - Intronic
1061678118 9:132229658-132229680 CCTTCCTCCACCTCCATGTCTGG - Intronic
1186105393 X:6200448-6200470 CACTTCTCCACCTTCATCCCAGG - Intronic
1193895466 X:87110024-87110046 GAATCCTCCACCTTCAGCTGAGG + Intergenic
1197005112 X:121487043-121487065 CTCTCCTCCACCGGCATGTCAGG - Intergenic
1200310686 X:155073858-155073880 CACTCCTACACCATCTTTTGTGG + Intronic
1201950112 Y:19554587-19554609 CACTCCTCCCTCTCCATGTGCGG + Intergenic