ID: 1077522901

View in Genome Browser
Species Human (GRCh38)
Location 11:3046735-3046757
Sequence GCACTCCTCCACCTTCATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 142}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077522901_1077522914 30 Left 1077522901 11:3046735-3046757 CCCACATGAAGGTGGAGGAGTGC 0: 1
1: 0
2: 1
3: 8
4: 142
Right 1077522914 11:3046788-3046810 AAGGCATACTTCAGTGATGATGG 0: 1
1: 0
2: 1
3: 7
4: 184
1077522901_1077522906 -1 Left 1077522901 11:3046735-3046757 CCCACATGAAGGTGGAGGAGTGC 0: 1
1: 0
2: 1
3: 8
4: 142
Right 1077522906 11:3046757-3046779 CCCACAGCCACAGGAGGAGCTGG 0: 1
1: 1
2: 6
3: 89
4: 1199
1077522901_1077522903 -10 Left 1077522901 11:3046735-3046757 CCCACATGAAGGTGGAGGAGTGC 0: 1
1: 0
2: 1
3: 8
4: 142
Right 1077522903 11:3046748-3046770 GGAGGAGTGCCCACAGCCACAGG 0: 1
1: 0
2: 6
3: 49
4: 343
1077522901_1077522910 11 Left 1077522901 11:3046735-3046757 CCCACATGAAGGTGGAGGAGTGC 0: 1
1: 0
2: 1
3: 8
4: 142
Right 1077522910 11:3046769-3046791 GGAGGAGCTGGGCCACCCAAAGG 0: 1
1: 0
2: 4
3: 46
4: 286
1077522901_1077522904 -7 Left 1077522901 11:3046735-3046757 CCCACATGAAGGTGGAGGAGTGC 0: 1
1: 0
2: 1
3: 8
4: 142
Right 1077522904 11:3046751-3046773 GGAGTGCCCACAGCCACAGGAGG 0: 1
1: 0
2: 2
3: 26
4: 231
1077522901_1077522908 0 Left 1077522901 11:3046735-3046757 CCCACATGAAGGTGGAGGAGTGC 0: 1
1: 0
2: 1
3: 8
4: 142
Right 1077522908 11:3046758-3046780 CCACAGCCACAGGAGGAGCTGGG 0: 1
1: 0
2: 10
3: 591
4: 16089

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077522901 Original CRISPR GCACTCCTCCACCTTCATGT GGG (reversed) Intronic
905972745 1:42153891-42153913 GTCCTCCTCCACCTACATGTGGG - Intronic
907330684 1:53669290-53669312 ACACTCCACCCCCTTCCTGTGGG - Intronic
907727198 1:57030537-57030559 CCTCTCTCCCACCTTCATGTTGG - Intronic
917411034 1:174760326-174760348 ACCCTCCTCCACCCTCAAGTAGG + Intronic
917916787 1:179710070-179710092 TCTCTGCTCCACCTTCCTGTTGG - Intergenic
919755265 1:201062464-201062486 GCACTCCTCCTCTGTCATCTTGG + Exonic
919853381 1:201689126-201689148 GAAGTCCTCCACCTTTTTGTAGG + Intronic
920116960 1:203628289-203628311 ACACTCCTCCACCTCCCTGAGGG + Intronic
920147287 1:203872845-203872867 GCCCTCCAGCAGCTTCATGTAGG + Intergenic
920910370 1:210210673-210210695 GCATTCCTCCTCCTGCGTGTGGG - Intergenic
922472697 1:225886775-225886797 GCACTTCTGCACCCTCATGTTGG + Exonic
922480510 1:225937489-225937511 GCACTTCTGCACCCTCATGTTGG + Exonic
922821211 1:228487151-228487173 GCGCTCCTCCGCCTTGATTTTGG - Exonic
922918681 1:229281129-229281151 GCACTCCTAGACATTCATCTCGG - Intronic
924919538 1:248613151-248613173 GCATTTCTCCATATTCATGTGGG + Intergenic
1062864917 10:844134-844156 GCCCTGCTCCACCCTCATCTCGG + Intronic
1063836298 10:10017873-10017895 TCCCACCTCCACCTTCAAGTAGG + Intergenic
1067743129 10:48912101-48912123 ACACTCTCACACCTTCATGTGGG - Intronic
1067941310 10:50659414-50659436 GGCCTCCTCCTCCTGCATGTGGG - Intergenic
1069676402 10:70251695-70251717 GCCATCCTCCACCTCCAGGTTGG - Exonic
1070862530 10:79684285-79684307 GGCCTCCTCCTCCTGCATGTGGG - Intergenic
1070862549 10:79684376-79684398 GGCCTCCTCCTCCTGCATGTGGG - Intergenic
1071257113 10:83880762-83880784 GCACTCCTCACCCTTTATTTAGG + Intergenic
1071456639 10:85856253-85856275 GCATTCCTCCTCCTTTCTGTGGG - Intronic
1073426864 10:103460211-103460233 CCACTCCTCCACCTACAAGCTGG - Intergenic
1073540859 10:104315482-104315504 GAAGTCCTCCACCTCCATGTCGG + Exonic
1074743163 10:116504679-116504701 TCACTCCTCCACCTTATTGCTGG + Intergenic
1075323419 10:121510678-121510700 CCGCTCCTCCCCCTTCATCTTGG + Intronic
1077522901 11:3046735-3046757 GCACTCCTCCACCTTCATGTGGG - Intronic
1079140163 11:17803328-17803350 GCACCCATCCATCTGCATGTAGG + Intronic
1082899163 11:58227231-58227253 GACCTCCTACACCTTCATGAGGG - Intergenic
1083663839 11:64264299-64264321 GAATTCCTCCAGCTCCATGTAGG + Intronic
1085522901 11:77148461-77148483 ACTCTCCTCCACCTTCAAATGGG + Intronic
1091199406 11:133762503-133762525 GCATTTCTCCACCTTCCTGCTGG + Intergenic
1091931927 12:4403234-4403256 GCCCTCCTCCAGCTTTCTGTGGG + Intergenic
1095719879 12:45388737-45388759 TCACTGCTCCACCTTCTGGTTGG + Intronic
1096241411 12:49962013-49962035 GCACACCTCCTTCTTCATGGTGG - Exonic
1096346846 12:50856051-50856073 CCACTTCTCCACCCTCAAGTAGG - Intronic
1096518702 12:52172209-52172231 GCCCTCCACCAGCTTCCTGTAGG + Exonic
1098504328 12:71231886-71231908 GCACTGATGCACCTTCATGGTGG + Intronic
1098850921 12:75594778-75594800 CCTTTCCTCCACCTTCAAGTAGG + Intergenic
1099256299 12:80317853-80317875 GCTCAGCTCCACCTTGATGTGGG + Intronic
1101419730 12:104540587-104540609 GTACTCCTCCACCCTCACCTGGG + Intronic
1101583648 12:106066249-106066271 GCACTCCTTCCCCATGATGTGGG + Exonic
1108110496 13:47066348-47066370 GCACTCCTCCACAAACATGCTGG - Intergenic
1116124545 14:40766234-40766256 GCACTCTTCCACCAGCAGGTTGG + Intergenic
1116995836 14:51323299-51323321 GCACCCCTCAACCTCCAGGTAGG + Intergenic
1119816694 14:77575387-77575409 GCCCTCCTCCACCTCCAAATGGG - Intronic
1120124766 14:80728354-80728376 CCCATCCTCCACCCTCATGTAGG - Intronic
1124641766 15:31400370-31400392 GCACGCCACCCCCTCCATGTGGG - Intronic
1128329501 15:66746317-66746339 GCTCTCCTCCTCCCTCCTGTGGG + Intronic
1132594540 16:742408-742430 GCACTCCTGCACCTGCCTGTGGG + Intronic
1135290076 16:21228758-21228780 GCTCTCATCAACCTTCCTGTTGG - Intergenic
1135952664 16:26929823-26929845 GCCACCCTCCACCTTCAAGTAGG + Intergenic
1137717847 16:50609811-50609833 GGACTCCTCCCCCTTGATCTGGG - Intronic
1137765547 16:50975094-50975116 GCACTCCACCATCTGCAAGTTGG + Intergenic
1138266490 16:55663566-55663588 GCACTCCCTCACCTTCACCTTGG + Intronic
1139209693 16:65065143-65065165 TCCCTCCTCCACCACCATGTCGG - Intronic
1141885908 16:86892018-86892040 GCACTCCCCCACCTTCAGGGCGG + Intergenic
1142264206 16:89056197-89056219 GCATTCCTGCACATTCATGGAGG - Intergenic
1142622674 17:1174956-1174978 GCACACCTCCACCCCCATTTTGG + Intronic
1143915531 17:10289727-10289749 GCACTTCTCAAACTTAATGTGGG + Intergenic
1144956237 17:19020231-19020253 GCACTCCTCCACCTTGACCCTGG + Intronic
1151986762 17:77548671-77548693 AAACTCCTCCACCTTGAAGTTGG - Intergenic
1152398829 17:80051771-80051793 GCACGCGTCCTCCTTCAGGTGGG - Intronic
1152567839 17:81108079-81108101 GGACTCCTCCGCCTGCTTGTAGG - Intronic
1152996944 18:416626-416648 GGACTCCTCCACCGCCATGCTGG + Intronic
1156618738 18:38822351-38822373 CCCATCCTCCACCTTCAAGTAGG - Intergenic
1161034743 19:2078284-2078306 GCAGTCCTGCCCCGTCATGTCGG - Exonic
1163524794 19:17814178-17814200 GTACTCCTCCTCCCTCCTGTGGG + Intergenic
1164581551 19:29438440-29438462 GGACTCTTCCACCTCCCTGTGGG - Intergenic
925975625 2:9140085-9140107 GGACTCCTCCACCTCGAAGTGGG + Intergenic
926232888 2:11018351-11018373 GCACTTCTGCACATTCAGGTTGG - Intergenic
926587660 2:14706176-14706198 GTTGGCCTCCACCTTCATGTGGG + Intergenic
927553775 2:24018781-24018803 GCCCTCCGCAGCCTTCATGTAGG + Intronic
927757476 2:25720553-25720575 GCAGTCCTCCCCCTTCGTGTTGG + Intergenic
928065909 2:28164316-28164338 GCACTCCTCTAACTCCACGTGGG - Intronic
928113750 2:28530233-28530255 GCTCTCCACCACCTCCCTGTGGG - Intronic
929279106 2:40058886-40058908 GAATTACTCCACTTTCATGTGGG + Intergenic
932281026 2:70491907-70491929 GCACATCTCCAGCTTCTTGTAGG + Intronic
937222498 2:120349840-120349862 GCACTCCTCCACAATCATGTTGG - Exonic
940535052 2:154930705-154930727 ACCATCCTCCACCTTCAAGTAGG + Intergenic
941653829 2:168122183-168122205 GCTATCCTCCACCCTCAAGTAGG + Intronic
943632932 2:190274398-190274420 GCACTAGTCAACTTTCATGTGGG + Intronic
944546271 2:200802068-200802090 CCAATCCTCCACCCTCAAGTAGG - Intergenic
944587550 2:201185920-201185942 GGACTTCTCCAGCTTCTTGTTGG - Exonic
944915356 2:204354823-204354845 TCACACCACCACCTTCCTGTAGG + Intergenic
948692071 2:239712314-239712336 GCACCCCTCCCTCTTAATGTGGG - Intergenic
1172009720 20:31839459-31839481 CCACTCCTAAACCTTCATGGAGG + Intergenic
1172167710 20:32909005-32909027 CCAAGCCTCCACCTTCTTGTGGG - Intronic
1173099967 20:40077142-40077164 GAAATCCTCCACTTTCATCTTGG - Intergenic
1174873240 20:54202756-54202778 GCACCCATCAACCTTCATCTAGG + Intergenic
1174894027 20:54429611-54429633 ACACTCCTGCACCTTCCTGCCGG - Intergenic
1175405005 20:58720173-58720195 GCCCTCCTCCAGCTTCCTGCAGG - Intergenic
1176145645 20:63564238-63564260 GTACTCCTTCACCATGATGTGGG + Exonic
1180016146 21:45085703-45085725 TCACTCATTCACCTGCATGTGGG - Intronic
1182239197 22:28901332-28901354 GCACTCTTCCATCTCCCTGTTGG + Intronic
1183778899 22:39985847-39985869 GCACTCCGCCTCTGTCATGTGGG + Intergenic
1185267806 22:49913658-49913680 GCTCTCCTCCACTTTGGTGTAGG + Exonic
949977428 3:9473738-9473760 GCACTGCTCCACAGGCATGTTGG - Intronic
950115432 3:10447661-10447683 GCTCCCCTCCACCATCAGGTTGG - Intronic
955202687 3:56865117-56865139 ACACTCCTCCACTTCCCTGTGGG + Intronic
955352364 3:58203257-58203279 GCACTCCTCCATCCTCTTTTTGG + Intronic
956390974 3:68772395-68772417 GCACTCACCCACCTTAATGATGG - Intronic
956724671 3:72147006-72147028 CCCCTCCTCCACCCTCAAGTAGG + Intergenic
963223165 3:142833015-142833037 CCCCTCCTCCACCCTCATGGAGG + Intronic
967114250 3:186322418-186322440 CCCATCCTCCACCTTCAAGTAGG - Intronic
968090828 3:195897250-195897272 GCAACCCTGCACCTTCAGGTCGG + Intronic
968138707 3:196238483-196238505 GCAGTCCCCCTCCTTCGTGTGGG + Exonic
976059967 4:81116183-81116205 GCTATCCTCCACCCTCAAGTAGG + Intronic
977163234 4:93662810-93662832 GCACTCTTCTTCCTTCATGAGGG - Intronic
980313583 4:131166462-131166484 GCATAACTCCATCTTCATGTGGG - Intergenic
984987110 4:185342026-185342048 CAACTCCTCCAACTTCTTGTAGG - Exonic
986233503 5:5886960-5886982 GTGCTCCTCCACGTTCGTGTTGG - Intergenic
986798370 5:11234316-11234338 GCATTCATCCACCTTCTTTTTGG - Intronic
987088092 5:14487857-14487879 GCTCTCCAGCACCTTCATCTTGG - Exonic
988976279 5:36519446-36519468 CCCATCCTCCACCCTCATGTAGG - Intergenic
1003830394 6:10003675-10003697 CCTGTCCTCCACCTTCAAGTAGG - Intronic
1005315531 6:24599521-24599543 GCCCTCCAGCACCTTCCTGTAGG - Intronic
1007275675 6:40671768-40671790 GCCCTTCTCCACCTAGATGTAGG + Intergenic
1012645783 6:101679371-101679393 GCACTACACCAGCTTAATGTTGG + Intronic
1015609854 6:135004969-135004991 GCTCTCCTTCACCTTTTTGTAGG - Intronic
1015624441 6:135165806-135165828 CCAGCCCTCCACCTTCAGGTAGG + Intergenic
1017327620 6:153158235-153158257 TCACTCCTTCAACTGCATGTGGG + Intergenic
1019539609 7:1545797-1545819 GCACGCCTCCAGCTTCCTGCGGG + Exonic
1020543163 7:9488161-9488183 TCCATCCTCCACCTTCAGGTAGG + Intergenic
1022184686 7:27955795-27955817 GCACTCCTCCACCACCCTTTAGG - Intronic
1026275485 7:68872253-68872275 ACACACCTCCTCCTGCATGTGGG + Intergenic
1026633038 7:72054753-72054775 TCCCTCCTTCACCTTCAAGTAGG - Intronic
1027178851 7:75923387-75923409 GCACACCTCCATCTTCTTGGGGG + Intronic
1028815118 7:95134382-95134404 GCACCCATCAACCTTCATCTAGG - Intronic
1030613954 7:111718175-111718197 CCACCCCTCCACCATCAAGTAGG + Intergenic
1038266281 8:26041889-26041911 GCGCTCCTCCAGCTCCAGGTTGG + Intronic
1039348503 8:36734507-36734529 GCACAACACCACCTTGATGTTGG + Intergenic
1045564826 8:103303131-103303153 GCACTCCAGGCCCTTCATGTGGG + Intronic
1049870648 8:144972835-144972857 CCACTCCTGCACATACATGTTGG - Intergenic
1050167280 9:2778617-2778639 CCAATCCTCCACCCTCAAGTAGG - Intronic
1050837723 9:10104780-10104802 GGATTACTCCACCTACATGTTGG - Intronic
1052527880 9:29643602-29643624 CTACTCCTCCACTTACATGTGGG + Intergenic
1052721700 9:32179138-32179160 GCACTCCAACATCTTCATGCTGG + Intergenic
1053270601 9:36746935-36746957 GGGCTCCTCCACCTTGATGGGGG - Intergenic
1053465757 9:38307173-38307195 GCACTCCTCCCACTGCATCTTGG - Intergenic
1053902494 9:42808269-42808291 TCACACCTTCTCCTTCATGTTGG + Intergenic
1055831857 9:80389045-80389067 CCACTCCTCCATCCTCAAGTAGG - Intergenic
1057748351 9:97770363-97770385 GAACTCCTCCACCTTCCTTGGGG - Intergenic
1061167239 9:128930557-128930579 GCTCACCTCAACCTCCATGTTGG - Intronic
1188774324 X:34194694-34194716 GGACTCTTCCACATTCATGTAGG + Intergenic
1189957715 X:46292986-46293008 TCACTCCTCCACTCTCTTGTCGG + Intergenic
1196227831 X:113187839-113187861 TCACTTCTCCTCCTTCTTGTAGG - Intergenic
1197252546 X:124230480-124230502 GCCCTCCTCCACCTCCATACGGG - Intronic
1198765337 X:140074596-140074618 GAACACTTCCACCTTCATGAGGG - Intergenic
1198771696 X:140137798-140137820 GAACACTTCCACCTTCATGAGGG - Intergenic