ID: 1077522902

View in Genome Browser
Species Human (GRCh38)
Location 11:3046736-3046758
Sequence GGCACTCCTCCACCTTCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 151}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077522902_1077522904 -8 Left 1077522902 11:3046736-3046758 CCACATGAAGGTGGAGGAGTGCC 0: 1
1: 0
2: 1
3: 9
4: 151
Right 1077522904 11:3046751-3046773 GGAGTGCCCACAGCCACAGGAGG 0: 1
1: 0
2: 2
3: 26
4: 231
1077522902_1077522908 -1 Left 1077522902 11:3046736-3046758 CCACATGAAGGTGGAGGAGTGCC 0: 1
1: 0
2: 1
3: 9
4: 151
Right 1077522908 11:3046758-3046780 CCACAGCCACAGGAGGAGCTGGG 0: 1
1: 0
2: 10
3: 591
4: 16089
1077522902_1077522910 10 Left 1077522902 11:3046736-3046758 CCACATGAAGGTGGAGGAGTGCC 0: 1
1: 0
2: 1
3: 9
4: 151
Right 1077522910 11:3046769-3046791 GGAGGAGCTGGGCCACCCAAAGG 0: 1
1: 0
2: 4
3: 46
4: 286
1077522902_1077522914 29 Left 1077522902 11:3046736-3046758 CCACATGAAGGTGGAGGAGTGCC 0: 1
1: 0
2: 1
3: 9
4: 151
Right 1077522914 11:3046788-3046810 AAGGCATACTTCAGTGATGATGG 0: 1
1: 0
2: 1
3: 7
4: 184
1077522902_1077522906 -2 Left 1077522902 11:3046736-3046758 CCACATGAAGGTGGAGGAGTGCC 0: 1
1: 0
2: 1
3: 9
4: 151
Right 1077522906 11:3046757-3046779 CCCACAGCCACAGGAGGAGCTGG 0: 1
1: 1
2: 6
3: 89
4: 1199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077522902 Original CRISPR GGCACTCCTCCACCTTCATG TGG (reversed) Intronic
902160906 1:14529719-14529741 GGCATTTCTCCACCCTCATCTGG - Intergenic
902879460 1:19361507-19361529 GGCGCTCCGGCACCTTCAGGAGG + Intronic
903133596 1:21294549-21294571 GGCACTGTTGCACCTTCATCTGG - Intronic
904292419 1:29496778-29496800 GCCACTCCTCCTCCTGCAGGGGG + Intergenic
905805389 1:40873321-40873343 GACCCCCCTCCACCTTCAAGAGG - Intergenic
905972746 1:42153892-42153914 TGTCCTCCTCCACCTACATGTGG - Intronic
907782248 1:57577959-57577981 GACACTCTTCAGCCTTCATGTGG - Intronic
908763329 1:67532143-67532165 GTCTCTGCTCCATCTTCATGCGG - Intergenic
911139783 1:94486733-94486755 GTGACTCCTTCACTTTCATGTGG - Intronic
912181132 1:107220306-107220328 GGCAATCCACCACCTTCAAAGGG + Intronic
918164998 1:181936546-181936568 GTCACTCCTCCACCACCATCAGG + Intergenic
919780210 1:201216476-201216498 GGCAATCCTGAACCTCCATGGGG - Exonic
920116959 1:203628288-203628310 TACACTCCTCCACCTCCCTGAGG + Intronic
920178848 1:204120281-204120303 AGCTCTCCTCCACACTCATGGGG - Intronic
920910371 1:210210674-210210696 GGCATTCCTCCTCCTGCGTGTGG - Intergenic
923274064 1:232381377-232381399 GGCACTTTGCCACATTCATGAGG + Intergenic
923987216 1:239394963-239394985 TCCTCTCATCCACCTTCATGAGG + Intronic
1063113726 10:3058103-3058125 GTCACTCCTCCTCCTGCAGGTGG + Intergenic
1065143254 10:22740425-22740447 GGGACTCTTCCACCACCATGTGG - Intergenic
1066650944 10:37654602-37654624 GGCAATCCACCTCCTTCAGGTGG - Intergenic
1067034498 10:42903080-42903102 GGCAATCCACCTCCTTCAAGGGG - Intergenic
1067561194 10:47305755-47305777 GGCACTCAGCCTCCTTCCTGAGG - Intronic
1070957382 10:80473457-80473479 GCCTCTCCTGCACCTGCATGTGG + Intronic
1071929671 10:90454272-90454294 TCCAATCCTCCACCTTCATGTGG - Intergenic
1073473528 10:103738578-103738600 GGCCCTCCCCCACCCTCCTGTGG - Intronic
1075297983 10:121294689-121294711 GGCAGGTCTCCACCTCCATGAGG - Intergenic
1075413404 10:122245752-122245774 GGGACTCTTCCTCCTTCTTGGGG + Intronic
1076226347 10:128779248-128779270 GGTACTCCTCCAACCCCATGAGG + Intergenic
1076575260 10:131461607-131461629 CACACTCCTCCATCTTCCTGAGG + Intergenic
1076784711 10:132744055-132744077 GCCACTCCTCCACCTCTGTGGGG - Intronic
1077024666 11:433802-433824 GGCACCCGCCCACCTTAATGTGG + Exonic
1077522096 11:3042586-3042608 GGCATTCCTCCGCCCTCCTGGGG - Intronic
1077522902 11:3046736-3046758 GGCACTCCTCCACCTTCATGTGG - Intronic
1082899164 11:58227232-58227254 CGACCTCCTACACCTTCATGAGG - Intergenic
1083769602 11:64859156-64859178 TCCACTCCTCAGCCTTCATGGGG - Intronic
1085517613 11:77120703-77120725 GGTTCTCCTCCACCTGCAGGAGG - Exonic
1090417194 11:126548623-126548645 GGCACCTCTGCACCTTCATGAGG + Intronic
1091192768 11:133708046-133708068 AGCTCTCCTCCATCTTCAAGGGG + Intergenic
1091931926 12:4403233-4403255 GGCCCTCCTCCAGCTTTCTGTGG + Intergenic
1092030136 12:5276970-5276992 GACCCTCTTCCACCTTCCTGGGG - Intergenic
1092087000 12:5770810-5770832 GGCTCTGCTCCAGCTACATGAGG + Intronic
1097167083 12:57091669-57091691 GGGACTCCTCCCCCTGCAGGGGG - Exonic
1099484571 12:83212551-83212573 AGCTCTCCTCCATCTTCCTGTGG - Intergenic
1108313825 13:49219855-49219877 AGCCCTCCTCCACCGTCAAGCGG + Intergenic
1109843768 13:67956678-67956700 GACACTCCTCCAACTTCTAGAGG + Intergenic
1110383652 13:74883093-74883115 GACACTTCTTCACCTTCCTGAGG - Intergenic
1118046354 14:61975552-61975574 GGCACTCTTCCCCCTTCACTTGG - Intergenic
1121053809 14:90836880-90836902 GGCACTTCTCCACCCTCACAGGG - Intergenic
1124200447 15:27674567-27674589 GGCACTAATCCCCATTCATGAGG - Intergenic
1126694272 15:51313004-51313026 CCCACTCTTGCACCTTCATGTGG + Intronic
1126703189 15:51385481-51385503 CCCCCTCCTCCACCTTCACGAGG + Intronic
1128329500 15:66746316-66746338 GGCTCTCCTCCTCCCTCCTGTGG + Intronic
1128606758 15:69042350-69042372 GGGACTCTGCCACCTTCATCAGG - Intronic
1132580328 16:681787-681809 GGCACTCTTCCAGCTCCCTGGGG - Exonic
1132594539 16:742407-742429 GGCACTCCTGCACCTGCCTGTGG + Intronic
1135350683 16:21726634-21726656 GGCACTGCTGCACTTTCCTGAGG - Exonic
1136220258 16:28823673-28823695 GGCCCTCCCCCAGCTTCACGGGG - Intronic
1137717848 16:50609812-50609834 GGGACTCCTCCCCCTTGATCTGG - Intronic
1141626878 16:85266113-85266135 GGCGCTCCCCCACCTCCCTGGGG - Intergenic
1142854555 17:2722614-2722636 GGGACTCCCCCTTCTTCATGGGG + Intergenic
1146901634 17:36592664-36592686 GGCCCTCCTCCACTCTCCTGGGG + Intronic
1147255080 17:39176512-39176534 GCCTCCCCTCCACCTCCATGGGG - Intronic
1147571815 17:41576172-41576194 GGCCCTCCTCCCCCTACATCTGG + Intergenic
1149863242 17:60135968-60135990 GGCCCTCCTCCTCCTTCGCGGGG + Intergenic
1150655119 17:67034155-67034177 ATCACTCCTCCACCCTCCTGGGG + Intergenic
1152226712 17:79096198-79096220 GGCCTTTCTCCCCCTTCATGGGG - Intronic
1152398830 17:80051772-80051794 GGCACGCGTCCTCCTTCAGGTGG - Intronic
1155347886 18:24876495-24876517 GAAACTTCTCCACCTTCCTGTGG - Intergenic
1157274014 18:46297369-46297391 GCCACTCCTCCACGTACTTGGGG - Intergenic
1158500428 18:57995907-57995929 AGCCCTCCTGCCCCTTCATGTGG - Intergenic
1160449559 18:78953001-78953023 GGCACTGCTCCATCTTGTTGGGG + Intergenic
1168338340 19:55609612-55609634 GGCATTCCTCCAAGGTCATGTGG - Intronic
925975624 2:9140084-9140106 GGGACTCCTCCACCTCGAAGTGG + Intergenic
926127025 2:10278108-10278130 GGCACTCCTCCACCCTCCTCTGG - Intergenic
926127065 2:10278216-10278238 GGCACTCCTCCTCCCTCCTCCGG - Intergenic
928398803 2:30963454-30963476 GCCGCTCCTCCACCTCTATGTGG - Intronic
932566319 2:72913252-72913274 GGCACTGCTCCAAGTTCATCAGG + Intergenic
934515207 2:94981995-94982017 AGCACACCTCCACTTTCATTGGG - Intergenic
936818327 2:116487446-116487468 AGCACTACTCCACCATCATATGG + Intergenic
937675321 2:124583771-124583793 GGAACTGCTCCACCTTCCTCTGG + Intronic
937991579 2:127665016-127665038 GGCAATCCTCCAGCTTCCAGGGG + Intronic
940627336 2:156191765-156191787 GGCCTTCTTCCAGCTTCATGTGG - Intergenic
942085764 2:172442285-172442307 GGCACTCCTCAACCTGCCTGGGG - Intronic
943827004 2:192408084-192408106 GCCCCTCCTCCACTATCATGGGG + Intergenic
943865191 2:192919226-192919248 GCCACTTCTCCACTTTCCTGGGG + Intergenic
947337228 2:229099993-229100015 GGCACTTGTCCCCCATCATGAGG - Intronic
947463394 2:230322108-230322130 GACATTCCTCCACCTTTCTGAGG + Intergenic
948692072 2:239712315-239712337 GGCACCCCTCCCTCTTAATGTGG - Intergenic
1171283671 20:23921219-23921241 GGCTCTCCTCCACCTTCCCTTGG - Intergenic
1171516776 20:25744821-25744843 GGCAGTCCTCCACTTTCAGCTGG + Intergenic
1175531826 20:59678816-59678838 GGCACTCCTCCTCCTTCTGCCGG + Intronic
1175760663 20:61560582-61560604 TGCACTCCAGCGCCTTCATGTGG + Intronic
1177791157 21:25723208-25723230 AGCTCTCCTCCACCTACCTGTGG - Intronic
1179488192 21:41724199-41724221 GTGTTTCCTCCACCTTCATGAGG + Intergenic
1180016147 21:45085704-45085726 GTCACTCATTCACCTGCATGTGG - Intronic
1181037545 22:20177196-20177218 GGCAGCCCTCCACCTTTATGTGG + Intergenic
1181260054 22:21591157-21591179 GGCCCCTCTCCACCTGCATGAGG - Intronic
1181798374 22:25327056-25327078 GGCACCCCTGCCCCTCCATGGGG - Intergenic
1183267859 22:36840397-36840419 CGCCCTCCGCCACCTCCATGTGG - Intergenic
1185135415 22:49068826-49068848 GGCAGGATTCCACCTTCATGAGG - Intergenic
1185390361 22:50557764-50557786 CTCATTCCTTCACCTTCATGAGG - Intronic
953437177 3:42887314-42887336 AGCAATCATGCACCTTCATGGGG + Intronic
954225513 3:49178356-49178378 GCCACTCCTCTGCCTTCATAAGG + Intronic
955202686 3:56865116-56865138 GACACTCCTCCACTTCCCTGTGG + Intronic
955232264 3:57109699-57109721 CCCACCCCTCCACCTTCATAAGG + Intronic
955493694 3:59509023-59509045 GTCCTTTCTCCACCTTCATGGGG + Intergenic
956405518 3:68924889-68924911 GGCACTCCTTGACCTTCATGGGG + Intronic
960452437 3:117826759-117826781 GGAACTCCTGCAGCTACATGAGG + Intergenic
961468491 3:127096563-127096585 GGCACTGCTGCATCTCCATGAGG + Intergenic
966621457 3:181968711-181968733 GGCACTACTCAAACATCATGAGG - Intergenic
968984685 4:3868763-3868785 GGCCCACCTCCTCCTTCTTGGGG + Intergenic
971098537 4:23435766-23435788 GGGAGGGCTCCACCTTCATGAGG + Intergenic
977163235 4:93662811-93662833 AGCACTCTTCTTCCTTCATGAGG - Intronic
977816348 4:101417350-101417372 GGCACACCTGCACCTGCAGGTGG - Intronic
980274535 4:130632915-130632937 GGCAATCCACCACCTTCAAAGGG - Intergenic
981915078 4:150024564-150024586 GGCACACCTCCAACTTTATAGGG + Intergenic
982726614 4:158913094-158913116 GGAACTCCTCCACATTGAAGAGG + Intronic
985708172 5:1413688-1413710 GGGCCTCCTCCACATCCATGTGG + Intronic
987500334 5:18700783-18700805 GGGACTCAATCACCTTCATGAGG + Intergenic
988230159 5:28466368-28466390 GGCACTCTTCCCCCTTCACGAGG + Intergenic
994628247 5:102249164-102249186 TGCACTGCTCCACTTACATGCGG + Intronic
996013712 5:118507965-118507987 GGCTTTCCTCCACCTTCACATGG + Intergenic
998359569 5:141573619-141573641 GGCATTCCTCCACCTCCACCCGG - Exonic
1002435994 5:179231160-179231182 GGCACTCGTCCACTCACATGAGG + Intronic
1002527457 5:179822719-179822741 GGCCCTCCGCCCCCTGCATGTGG + Intronic
1005597194 6:27390476-27390498 GGGATTCCTCCACCATAATGTGG - Intronic
1010042818 6:71406720-71406742 AGCATTCGTCCACTTTCATGAGG - Intergenic
1010050660 6:71500235-71500257 GGGAAGCTTCCACCTTCATGTGG + Intergenic
1018146735 6:160898602-160898624 GGAAGTCCTCCACAATCATGAGG + Intergenic
1018979606 6:168592496-168592518 GGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979627 6:168592601-168592623 GGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979933 6:168594134-168594156 GGAGCTCCTCCTCCTTCCTGAGG + Intronic
1018979985 6:168594395-168594417 GGAGCTCCTCCTCCTTCCTGAGG + Intronic
1019539608 7:1545796-1545818 TGCACGCCTCCAGCTTCCTGCGG + Exonic
1020560953 7:9728213-9728235 GGCGCTCCTCCGTCTTCCTGTGG + Intergenic
1020677593 7:11199543-11199565 GGCACTACCCCACCTTCTTTAGG + Intergenic
1022611509 7:31879085-31879107 GGCTGGCCTCCACCTTCACGCGG - Exonic
1027178850 7:75923386-75923408 GGCACACCTCCATCTTCTTGGGG + Intronic
1029418016 7:100455865-100455887 GCCACCTCTGCACCTTCATGTGG + Intergenic
1032079466 7:128851436-128851458 GCCACACCTCCACCTACAGGGGG + Exonic
1035980242 8:4362279-4362301 TGGACTCCTCCTCCTTCAGGTGG + Intronic
1036845652 8:12168288-12168310 AGCACCCACCCACCTTCATGAGG - Intergenic
1036867020 8:12410607-12410629 AGCACCCACCCACCTTCATGAGG - Intergenic
1043637646 8:82406287-82406309 GGCACTCATCAACTTTCATTAGG + Intergenic
1045016129 8:98003288-98003310 GGAACTCCTCCTCCTCCCTGGGG + Intronic
1050434707 9:5597040-5597062 GGCCCTCCTCCCTTTTCATGGGG - Intergenic
1053270602 9:36746936-36746958 TGGGCTCCTCCACCTTGATGGGG - Intergenic
1055935995 9:81604756-81604778 GGCACTCATCCACCTGCACATGG + Intronic
1056081848 9:83103031-83103053 GGCCCTCCTCCTCCTTCAGTGGG + Intergenic
1056691982 9:88815544-88815566 GGCACTCATTCACTTTCAAGAGG + Intergenic
1057125235 9:92611348-92611370 GGCCCTCCTCCTGCTCCATGGGG + Exonic
1057748352 9:97770364-97770386 TGAACTCCTCCACCTTCCTTGGG - Intergenic
1059505367 9:114794086-114794108 GTTACTCTTCCACCATCATGTGG - Intronic
1059696296 9:116733277-116733299 GTCAAGCCTCCTCCTTCATGAGG - Intronic
1061081118 9:128371075-128371097 GGCTCTCCTCCGCCTGCTTGTGG + Intergenic
1192875777 X:75228155-75228177 AGGACTCATCCAACTTCATGAGG + Intergenic
1195616443 X:106916276-106916298 GGCCCTACTCCACCTTCAGCTGG - Intronic
1196903200 X:120406854-120406876 GGAACTCCTCCACTTTCCTCTGG - Intergenic
1197252547 X:124230481-124230503 AGCCCTCCTCCACCTCCATACGG - Intronic
1198765338 X:140074597-140074619 AGAACACTTCCACCTTCATGAGG - Intergenic
1198771697 X:140137799-140137821 AGAACACTTCCACCTTCATGAGG - Intergenic
1200914411 Y:8558734-8558756 GGCACTCCTCCATCTTCTTAGGG + Intergenic