ID: 1077522908

View in Genome Browser
Species Human (GRCh38)
Location 11:3046758-3046780
Sequence CCACAGCCACAGGAGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 16691
Summary {0: 1, 1: 0, 2: 10, 3: 591, 4: 16089}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077522899_1077522908 2 Left 1077522899 11:3046733-3046755 CCCCCACATGAAGGTGGAGGAGT 0: 1
1: 0
2: 0
3: 12
4: 176
Right 1077522908 11:3046758-3046780 CCACAGCCACAGGAGGAGCTGGG 0: 1
1: 0
2: 10
3: 591
4: 16089
1077522901_1077522908 0 Left 1077522901 11:3046735-3046757 CCCACATGAAGGTGGAGGAGTGC 0: 1
1: 0
2: 1
3: 8
4: 142
Right 1077522908 11:3046758-3046780 CCACAGCCACAGGAGGAGCTGGG 0: 1
1: 0
2: 10
3: 591
4: 16089
1077522894_1077522908 24 Left 1077522894 11:3046711-3046733 CCAGAAAACAGCACTAAACCTGC 0: 1
1: 0
2: 0
3: 17
4: 430
Right 1077522908 11:3046758-3046780 CCACAGCCACAGGAGGAGCTGGG 0: 1
1: 0
2: 10
3: 591
4: 16089
1077522897_1077522908 6 Left 1077522897 11:3046729-3046751 CCTGCCCCCACATGAAGGTGGAG 0: 1
1: 0
2: 2
3: 21
4: 254
Right 1077522908 11:3046758-3046780 CCACAGCCACAGGAGGAGCTGGG 0: 1
1: 0
2: 10
3: 591
4: 16089
1077522893_1077522908 27 Left 1077522893 11:3046708-3046730 CCACCAGAAAACAGCACTAAACC 0: 1
1: 0
2: 0
3: 12
4: 209
Right 1077522908 11:3046758-3046780 CCACAGCCACAGGAGGAGCTGGG 0: 1
1: 0
2: 10
3: 591
4: 16089
1077522900_1077522908 1 Left 1077522900 11:3046734-3046756 CCCCACATGAAGGTGGAGGAGTG 0: 1
1: 0
2: 0
3: 11
4: 164
Right 1077522908 11:3046758-3046780 CCACAGCCACAGGAGGAGCTGGG 0: 1
1: 0
2: 10
3: 591
4: 16089
1077522902_1077522908 -1 Left 1077522902 11:3046736-3046758 CCACATGAAGGTGGAGGAGTGCC 0: 1
1: 0
2: 1
3: 9
4: 151
Right 1077522908 11:3046758-3046780 CCACAGCCACAGGAGGAGCTGGG 0: 1
1: 0
2: 10
3: 591
4: 16089

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077522908 Original CRISPR CCACAGCCACAGGAGGAGCT GGG Intronic
Too many off-targets to display for this crispr