ID: 1077523518

View in Genome Browser
Species Human (GRCh38)
Location 11:3050321-3050343
Sequence CTGTGGCTGCTTGGAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 480
Summary {0: 1, 1: 0, 2: 5, 3: 48, 4: 426}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077523518_1077523525 0 Left 1077523518 11:3050321-3050343 CCACCCACTCCAAGCAGCCACAG 0: 1
1: 0
2: 5
3: 48
4: 426
Right 1077523525 11:3050344-3050366 GCACCCAGAAGCAAAGCTCTGGG 0: 1
1: 0
2: 3
3: 23
4: 220
1077523518_1077523528 22 Left 1077523518 11:3050321-3050343 CCACCCACTCCAAGCAGCCACAG 0: 1
1: 0
2: 5
3: 48
4: 426
Right 1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG 0: 1
1: 0
2: 1
3: 3
4: 87
1077523518_1077523524 -1 Left 1077523518 11:3050321-3050343 CCACCCACTCCAAGCAGCCACAG 0: 1
1: 0
2: 5
3: 48
4: 426
Right 1077523524 11:3050343-3050365 GGCACCCAGAAGCAAAGCTCTGG 0: 1
1: 0
2: 3
3: 34
4: 532

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077523518 Original CRISPR CTGTGGCTGCTTGGAGTGGG TGG (reversed) Intronic
900509178 1:3050355-3050377 CGGAAGCTGCTTGGAATGGGAGG - Intergenic
900529714 1:3146990-3147012 ATGTGTGTGCTTGGTGTGGGGGG + Intronic
900766709 1:4510780-4510802 CTGTTGATGTTTGGGGTGGGAGG + Intergenic
901294210 1:8147916-8147938 CTGCGGCTGTTTGGAGAAGGTGG - Intergenic
902055411 1:13596536-13596558 CAGTGGCTGCTTGAAGTTGAGGG + Intronic
902256624 1:15193260-15193282 CAGTGGCAGCCTGGAGAGGGAGG - Intronic
902521468 1:17020116-17020138 AGGTGGCTGGGTGGAGTGGGAGG + Intronic
902866697 1:19284658-19284680 CTGTGGGTGCTTGGTGTGGATGG - Intronic
904422189 1:30401393-30401415 CAGGCGCTGCTTGGCGTGGGAGG - Intergenic
904773047 1:32891592-32891614 CCGTGGCTGGCTAGAGTGGGTGG - Intronic
904860361 1:33533207-33533229 CTCTGGCTGCCTGCAGTGGTGGG + Exonic
905036757 1:34923700-34923722 CTGTGGGTGCTGGGAGGTGGTGG - Intronic
905106072 1:35564366-35564388 CTCTGGCTGTTTGCAGGGGGAGG + Intronic
905294894 1:36947987-36948009 GTGAGGCTGCTTGGAGGAGGTGG - Intronic
905340694 1:37275383-37275405 CTGTGGCTGCAGGGAGAGGATGG - Intergenic
906130064 1:43450658-43450680 CTGTGGGTGTTTGGGGAGGGCGG - Exonic
906147594 1:43569225-43569247 CTGGGGCTGCAGGGGGTGGGGGG - Intronic
906787727 1:48630511-48630533 CTGTGGCTGATGGGAGAGGAAGG - Intronic
907311359 1:53540810-53540832 CTGGGGCTGCCTGGGGAGGGCGG + Intronic
909759269 1:79269051-79269073 ATGTCTCTGCTTGGAGTTGGGGG - Intergenic
911330867 1:96524263-96524285 CTGTGGCTGCCTCTAGTGGATGG - Intergenic
911454910 1:98110742-98110764 GTGAAGCTGCTTGGAGAGGGAGG + Intergenic
911927157 1:103848345-103848367 CTTTGGGAGGTTGGAGTGGGTGG - Intergenic
912383492 1:109260093-109260115 CTGCTGCTGCTAGGGGTGGGGGG + Intronic
912823754 1:112887250-112887272 CTGTGGGAGCCTGGGGTGGGTGG - Intergenic
913335108 1:117702724-117702746 CTGTGGCTGCCATGAGTGGAAGG - Intergenic
914431387 1:147622906-147622928 CTGTGGCTGCTTGTGGTTTGAGG - Intronic
916987499 1:170207462-170207484 CTGAGGCTGCATGGAGCAGGTGG - Intergenic
917494667 1:175529463-175529485 CTGTGGCTGCCTGGCGAGTGGGG + Intronic
919733304 1:200928420-200928442 CAGTGAGTGCTTGGAGTGGGGGG + Intergenic
920265771 1:204721501-204721523 CTCTGGCTCCTTGGAGTGGTGGG + Intergenic
920616473 1:207497041-207497063 CCGTGGTGGCTTGGTGTGGGGGG - Intronic
923208577 1:231782062-231782084 CTGTAGCTGCTTTCAGTGGGGGG + Intronic
1063254881 10:4316423-4316445 ATGTGGCTACTTGGAAAGGGTGG + Intergenic
1063537621 10:6900644-6900666 GTGTTGGTGCTTGGAGTGGCCGG - Intergenic
1063691437 10:8290990-8291012 TTCTGGCTGCATGGAGTGGATGG + Intergenic
1064798570 10:19042038-19042060 CTGTGGCCTGTTGGAGTGGATGG - Intergenic
1064887632 10:20128667-20128689 TGGTGGCTGCTAGAAGTGGGGGG - Intronic
1067677658 10:48398825-48398847 CAGTGGTTGCTAGGAGTTGGGGG + Intronic
1069639928 10:69948070-69948092 ATGGGGCTTCCTGGAGTGGGGGG + Intronic
1070253449 10:74793678-74793700 CTCTGGCTGTTGGGAGTGAGTGG - Intergenic
1071835420 10:89413012-89413034 CTGGGGCTTGTTGGAGTTGGGGG - Intronic
1071894337 10:90049447-90049469 CTTTGGCAGCTTGAGGTGGGAGG + Intergenic
1073176400 10:101560049-101560071 CTGGCTCTGCTTGGATTGGGTGG + Intergenic
1073457499 10:103646537-103646559 CTGTGGGTGCTGGGGGTGGGAGG - Intronic
1073827227 10:107337521-107337543 CTCTGGCTGCTGGGAGGTGGGGG + Intergenic
1073929228 10:108555308-108555330 CTGAGGCTGCATAGAGTAGGTGG - Intergenic
1074031870 10:109697079-109697101 CTGTGGCTGTGTGCAGTGTGTGG - Intergenic
1074676820 10:115860638-115860660 CTGTGGCTGCATGCAGTTGGAGG - Intronic
1075102703 10:119517476-119517498 CTGTGGCTTCATGGAGCTGGTGG - Intronic
1075754447 10:124800047-124800069 CTGTAGCGTCTTGGGGTGGGAGG - Intergenic
1076805931 10:132858724-132858746 CTGTGGCTGGTGGGGGTGGGTGG + Intronic
1077403555 11:2370798-2370820 CTGGGGCTTCGTGGACTGGGTGG - Intergenic
1077410757 11:2402921-2402943 CTTTGACTGCCTGGAGGGGGCGG + Exonic
1077523518 11:3050321-3050343 CTGTGGCTGCTTGGAGTGGGTGG - Intronic
1077552821 11:3209018-3209040 GTGTGGCTGCCTGGAGGAGGAGG + Intergenic
1077838319 11:5944935-5944957 CTGTGGCTGCTGTCAGTGGAGGG - Intergenic
1078150623 11:8756723-8756745 CTGGGGCTGCTTGTAGGAGGTGG - Intronic
1078611121 11:12820330-12820352 CTGTGGGTGGGTGGGGTGGGAGG - Intronic
1078753414 11:14186573-14186595 GAGAGGCTGGTTGGAGTGGGTGG - Intronic
1079173052 11:18114490-18114512 CTGTGGCTGCTGGGGGCAGGGGG + Intronic
1080553244 11:33392643-33392665 CCATGGTTGCTTGGATTGGGTGG - Intergenic
1080776620 11:35392783-35392805 ATGTGTATGCTTGGAGAGGGAGG + Intronic
1082820109 11:57538855-57538877 CTGTGAATGCTGGGGGTGGGTGG + Intergenic
1083272573 11:61579850-61579872 CTGGGGGTGCTGGGACTGGGTGG + Intronic
1084183525 11:67458324-67458346 CTGAGGCAGCTTTGGGTGGGAGG + Intronic
1084321076 11:68373662-68373684 CTGGGGCTGTGTGGAGGGGGTGG - Intronic
1084383497 11:68828291-68828313 CAGGGGCTTCTTGGAGAGGGGGG + Intronic
1084870376 11:72094820-72094842 CTGTGGAGGGTTGGAGTGGAGGG + Intronic
1085790666 11:79494401-79494423 CTGAGGGTTCTTGGGGTGGGGGG + Intergenic
1086106974 11:83157219-83157241 CTGTGGCGGCTGGAAGTGGACGG + Exonic
1087806494 11:102561158-102561180 CAGTAGGTGCTTGCAGTGGGGGG - Intergenic
1088834901 11:113569242-113569264 CTGTGGGTCCTTGGGGTGGGAGG - Intergenic
1089295927 11:117468110-117468132 CTGTGGCTGTTTGGAGAGGCGGG - Intronic
1089334501 11:117713783-117713805 CTGTGGCTGTGTGGAGGTGGTGG + Intronic
1089702949 11:120256439-120256461 CTGAGGCTCCCTGGAGTGGCTGG - Intronic
1091595792 12:1878376-1878398 CTCTGGCAGCTTGGAGTGCACGG - Exonic
1091917852 12:4282245-4282267 ATGTGGGTGCCTGGAGAGGGAGG - Intronic
1096977319 12:55707095-55707117 CTGTCTCTGCTTAGAATGGGAGG - Intronic
1097198014 12:57254972-57254994 CAGGGGCTGCCTGGAGGGGGTGG - Exonic
1098343003 12:69470705-69470727 CTGTGGGTCCATGGGGTGGGCGG + Intronic
1099072914 12:78069081-78069103 CTCCGGCTGCATAGAGTGGGTGG + Intronic
1099133667 12:78865446-78865468 CTGTGCGTGCTTAGGGTGGGAGG - Intronic
1101574006 12:105980811-105980833 CTGGGGCTCTTTGGAGAGGGGGG + Intergenic
1101914868 12:108888207-108888229 CTCAGGCTCCTTGGAGAGGGTGG + Intronic
1102901621 12:116642847-116642869 GAGTGGCTGCTTGGAGTGCTGGG + Intergenic
1103701543 12:122850708-122850730 CGGTGGCCGCTGGGTGTGGGGGG + Intronic
1103744286 12:123111592-123111614 GTGTGGCTGCAGGGAGCGGGCGG + Intronic
1104036987 12:125104486-125104508 CTGTGACCACTAGGAGTGGGAGG + Intronic
1104051376 12:125196102-125196124 CAATGGCTGCTTGGACTGAGTGG + Intronic
1104463052 12:128970467-128970489 CTGTGGCTGCGGGGAGGGAGTGG - Intronic
1104685362 12:130781138-130781160 CTGTGGCTGCTCGGTGTGGGTGG + Intergenic
1104809715 12:131612788-131612810 ATGTGGCTTCTCGGGGTGGGGGG - Intergenic
1104829740 12:131741957-131741979 CTGTGTGTTCTTGGTGTGGGTGG + Intronic
1104856750 12:131905735-131905757 CTGTGGCTGCGGGGAGTGAGTGG + Intronic
1104917247 12:132272085-132272107 CTGGGGCTGCTCTGAGTTGGGGG - Intronic
1104918189 12:132277290-132277312 CCGTGGCTGCTTGCAGGGGATGG + Intronic
1106083838 13:26522881-26522903 CTCTGGCTGCCAGGGGTGGGGGG - Intergenic
1106253330 13:28000800-28000822 CTGTGGGTGCATGGAGTGCTAGG + Intergenic
1106330076 13:28732076-28732098 CTGAGGTGGGTTGGAGTGGGCGG + Intergenic
1106772800 13:32978565-32978587 CTGCTGCTGCTTGGAGGTGGAGG - Intergenic
1109026165 13:57152881-57152903 CTGCGGCTACTTGGGGGGGGGGG - Intronic
1109027157 13:57159452-57159474 CTGCGGCTACTTGGGGGGGGGGG - Intergenic
1109028143 13:57166017-57166039 CTGCGGCTACTTGGGGGGGGGGG - Intergenic
1109029130 13:57172588-57172610 CTGCGGCTACTTGGGGGGGGGGG - Intergenic
1110116156 13:71819066-71819088 CTGGGGCTGCCAGGTGTGGGAGG + Intronic
1113605230 13:111600128-111600150 CTGTGGCAAAGTGGAGTGGGTGG + Intronic
1113924907 13:113936162-113936184 GTGTGGCTGCTTGGAGTCTCTGG + Intergenic
1115405400 14:33009834-33009856 CTGCGCCTGCTTGGTGTTGGAGG - Intronic
1116293984 14:43081154-43081176 CAGTGGCTGCTGGGGCTGGGTGG - Intergenic
1116997199 14:51336236-51336258 GTGTGTGTGCGTGGAGTGGGAGG + Intergenic
1118762667 14:68890250-68890272 CTGGGGCTGCCTGGAGCAGGTGG - Exonic
1118857584 14:69636194-69636216 CTCTTGCTGCCTGGAGTGGGCGG + Intronic
1118872969 14:69758699-69758721 CTCTGGAGGGTTGGAGTGGGAGG + Intronic
1118895591 14:69942995-69943017 CTGTGGCTGCTGGTGGTGGGGGG + Intronic
1119481919 14:74963292-74963314 CTGAGGCTTCTTGGAGAAGGAGG + Intergenic
1119741121 14:77014327-77014349 CTGTGTCTGCCTGGAGCTGGAGG - Intergenic
1119741291 14:77015278-77015300 CTGTGGCTGGTGGGAGAGGGAGG + Intergenic
1120442250 14:84556561-84556583 CTGTTTGTGGTTGGAGTGGGTGG - Intergenic
1121221607 14:92289489-92289511 ATGTGGCTGTTTGGAGAGTGGGG - Intergenic
1121253658 14:92516619-92516641 CTGGGGCTTCTCGGGGTGGGGGG - Intronic
1121736377 14:96220839-96220861 CTGAGGCTACCTGGAGTGCGTGG + Intronic
1122546703 14:102526874-102526896 CCGTGGCCATTTGGAGTGGGAGG + Intergenic
1122722172 14:103728236-103728258 CTGTGGCTCCTCGGAGGGGCCGG + Intronic
1122824113 14:104361362-104361384 CTGTGGCTGCCTTAAGTGGCTGG + Intergenic
1123093299 14:105751643-105751665 GTGTGGCTGGTGGGGGTGGGAGG + Intergenic
1124861763 15:33448872-33448894 CTGCGGCTGCCTGGAGTGTGGGG + Intronic
1127029354 15:54844903-54844925 CTGTGACTGCTAGGAGGGAGGGG - Intergenic
1127377059 15:58394612-58394634 CTGTGGCTGCCTTGTGTGGTTGG - Intronic
1127419722 15:58793205-58793227 CTTTGGGTGCTTGAGGTGGGTGG + Intronic
1127469621 15:59278939-59278961 TTGCCTCTGCTTGGAGTGGGTGG + Intronic
1128389826 15:67175327-67175349 ATGGGGCAGCTTGGAGTGAGAGG + Intronic
1129947319 15:79550349-79550371 CTGTGGATGCTCAGAGTGAGTGG + Intergenic
1130712973 15:86302163-86302185 CTAAGGCTGGTTGAAGTGGGTGG + Intronic
1131200507 15:90391577-90391599 GAGTGGCTGCTTGGTTTGGGAGG + Intronic
1131507636 15:93031339-93031361 CTGGGGCTGGTTGCAGTGAGGGG - Intergenic
1132098883 15:99008515-99008537 GGCTGGCTGCTTGGAGTGCGGGG + Intergenic
1132161503 15:99547310-99547332 CTGTGGCTGATGGGAGATGGGGG - Intergenic
1132868628 16:2105702-2105724 GTGTGGCTGCTGGGAGCGGAAGG + Intronic
1132884579 16:2177006-2177028 CACTGGCTGCTGTGAGTGGGGGG + Exonic
1133231120 16:4367066-4367088 CTGTGGCTCCTGGAAGTGTGGGG - Intronic
1133423368 16:5666006-5666028 CTCTGACTGGTTTGAGTGGGTGG - Intergenic
1133871402 16:9690003-9690025 CTGTGGCTGCCAGGAGTTAGAGG - Intergenic
1134238223 16:12484586-12484608 GTGTGGCTGAGTGGAGAGGGTGG - Intronic
1136172504 16:28497317-28497339 CTGTGGCTGCTGGGATTATGGGG + Exonic
1137845412 16:51683279-51683301 ATGTGTCTGCTTGAAGAGGGAGG - Intergenic
1138061433 16:53895108-53895130 CTGTGGGGAATTGGAGTGGGTGG - Intronic
1138510192 16:57504199-57504221 CTGTGGGTCCTGGCAGTGGGGGG - Intergenic
1139215413 16:65121822-65121844 TTGGGGCTTCTTGGAATGGGGGG - Intronic
1139380176 16:66525606-66525628 CTGTGGCTGCCTGGAGGGCCAGG - Intronic
1139939576 16:70595559-70595581 CTGTGGGAGGTTGAAGTGGGAGG - Intronic
1139949690 16:70663025-70663047 CAGGGGCTGCTTGGGGGGGGGGG - Exonic
1140222439 16:73053746-73053768 CTGTGGCTGCCTGGGGAAGGGGG - Intronic
1140774522 16:78238013-78238035 ATGTGGCTGTTTGGAGCAGGAGG + Intronic
1141644069 16:85358110-85358132 CTGTGGCTGGCGGGAGTGGGAGG - Intronic
1141708169 16:85681166-85681188 CTGTTTCTCCTTGGAGTAGGTGG - Intronic
1142159307 16:88548374-88548396 CTGTGGCTGGTGCGTGTGGGAGG - Intergenic
1142946045 17:3428095-3428117 CTGGGGCTTGTTGGGGTGGGGGG + Intergenic
1143021356 17:3918465-3918487 GTGTGGCTCCTTGGAGGAGGAGG - Intergenic
1143163457 17:4885973-4885995 CTGAGTCTGCCGGGAGTGGGAGG + Intronic
1143205755 17:5138604-5138626 CTGTGGGTGCTTGCAGGGAGGGG - Intronic
1143775128 17:9194424-9194446 CTGTGGCTTCGTGGAGTGAGTGG + Intronic
1144638398 17:16924970-16924992 CTGAGGCTGCTTGAAGGTGGGGG + Intergenic
1144836587 17:18159536-18159558 CTGGGGCTTCCTGGGGTGGGTGG + Intronic
1144876799 17:18401291-18401313 CTGTGGGTGCTTGTAGGGAGGGG - Intergenic
1144953101 17:19004481-19004503 CAGTAGCTTCTTAGAGTGGGAGG + Intronic
1145155429 17:20543127-20543149 CTGTGGGTGCTTGTAGGGAGTGG + Intergenic
1145239734 17:21233593-21233615 CTGAGGCTTCTAAGAGTGGGAGG - Intergenic
1146442922 17:32912773-32912795 CTGTTGGTGCTGGGTGTGGGTGG + Intergenic
1146521929 17:33532079-33532101 CTGTGGCTGGATGCAGTGAGAGG + Intronic
1146807691 17:35878422-35878444 CTGTGGCTGCTTGCAGCTGGAGG + Intronic
1146842855 17:36167190-36167212 CTGTGGGTGCTTGCAGGGAGGGG + Intronic
1146855160 17:36255131-36255153 CTGTGGGTGCTTGCAGGGAGGGG + Intronic
1146865460 17:36333244-36333266 CTGTGGGTGCTTGCAGGGAGGGG - Intronic
1146871066 17:36379042-36379064 CTGTGGGTGCTTGCAGGGAGGGG + Intronic
1146878426 17:36430124-36430146 CTGTGGGTGCTTGCAGGGAGGGG + Intronic
1146882375 17:36451270-36451292 CTGTGGGTGCTTGCAGGGAGGGG + Intergenic
1146928795 17:36763593-36763615 CAGAGGCTGCTGGGAGTGTGAGG - Intergenic
1147068321 17:37933838-37933860 CTGTGGGTGCTTGCAGGGAGGGG - Intronic
1147073952 17:37979666-37979688 CTGTGGGTGCTTGCAGGGAGGGG + Intronic
1147079852 17:38013393-38013415 CTGTGGGTGCTTGCAGGGAGGGG - Intronic
1147085473 17:38059204-38059226 CTGTGGGTGCTTGCAGGGAGGGG + Intronic
1147095793 17:38137335-38137357 CTGTGGGTGCTTGCAGGGAGGGG - Intergenic
1147101420 17:38183170-38183192 CTGTGGGTGCTTGCAGGGAGGGG + Intergenic
1147953844 17:44121720-44121742 CTGCAGCTACTTGGGGTGGGTGG + Intronic
1148556549 17:48582052-48582074 CTGTGGCTGCCAGGAGAAGGCGG - Intronic
1148769130 17:50056767-50056789 CTCTGGCTGCTGGGGGTTGGCGG + Intronic
1148992910 17:51681936-51681958 CTGTGGCTGTTTGGGGTGAAGGG + Intronic
1149682757 17:58517527-58517549 CTGGGGCTGCTGCCAGTGGGCGG - Intronic
1149846019 17:60009676-60009698 CTGTGGGTGCTTGCAGGGAGGGG + Intergenic
1150084368 17:62266256-62266278 CTGTGGGTGCTTGCAGGGAGGGG + Intergenic
1151830214 17:76545002-76545024 CTGTGGCTGCCTGGGCTTGGAGG + Intronic
1151947433 17:77327331-77327353 CTCTGGCCGTTCGGAGTGGGGGG - Intronic
1152218672 17:79048994-79049016 CTGGGGCTGATTTGTGTGGGAGG - Exonic
1152287466 17:79421359-79421381 GTGGGGCTGCTTGAAGTGGATGG + Intronic
1152824002 17:82452510-82452532 GTGTGGCAACTTGAAGTGGGGGG - Intergenic
1153872647 18:9334830-9334852 CTGCGGCGGCTTTGAGTGCGAGG - Exonic
1154425664 18:14270228-14270250 CTGTGGCTGCATATAGAGGGGGG - Intergenic
1156049612 18:32916599-32916621 CTGTGTCTCCATGGATTGGGTGG - Intergenic
1156200279 18:34822608-34822630 CAGTGGGTGCTAGGATTGGGTGG + Intronic
1157163320 18:45335188-45335210 CAGAGGCTGCTTGGAGTGGGTGG - Intronic
1158417215 18:57259049-57259071 TGCTGGCTGCTTGGAGTTGGAGG + Intergenic
1160323530 18:77918775-77918797 CTGTAGCTACTTGGAGTGAAAGG + Intergenic
1160389895 18:78522056-78522078 CAGTGGCTGCTTGGGGTGGCCGG - Intergenic
1160850499 19:1189302-1189324 CAGTGGCTGCTTGCACTGGCTGG + Intronic
1160868103 19:1264989-1265011 CTGAGGCTGCATGGAGGTGGGGG + Intronic
1161026506 19:2039673-2039695 CTGCGCCAGCTTGGACTGGGAGG + Exonic
1161572317 19:5037244-5037266 CTGGGGCTTCCTGGAGAGGGGGG + Intronic
1162312865 19:9917523-9917545 CTGTGTCTGCTTGGGGTGGAGGG + Intronic
1162541683 19:11300374-11300396 CAATGGCTGGTTGGAGTTGGTGG - Intronic
1162608427 19:11730337-11730359 CTCTGGGAGGTTGGAGTGGGAGG + Intronic
1162949480 19:14062060-14062082 ACTTGGCTGCCTGGAGTGGGGGG + Intergenic
1164272053 19:23681489-23681511 CTCTGGGTGCCTGGAATGGGAGG - Intronic
1164438683 19:28254705-28254727 CTGTGGGGGGTTGGAGTTGGTGG - Intergenic
1165047960 19:33121222-33121244 CTGTGGGAGGTTGAAGTGGGTGG - Intronic
1165768785 19:38366565-38366587 ATCTGGCTGCATGGGGTGGGGGG + Intronic
1165833011 19:38738434-38738456 ATGGGGCTGCGTGGAGTGGACGG - Exonic
1166231110 19:41426372-41426394 CAGTGGCTGCCTGGAGGTGGTGG - Exonic
1166716012 19:44968340-44968362 ATGTGGTTACCTGGAGTGGGAGG + Intronic
1166824105 19:45598679-45598701 GTGTGGCAGCTGGGAGTGTGAGG + Intronic
1167323800 19:48812250-48812272 CTGTGGCTGTTAGGGGTGGCAGG - Intergenic
1167622453 19:50567510-50567532 CCGCTGCTGCTTGGGGTGGGGGG - Intronic
1167669806 19:50844225-50844247 CTGTGGCTGCTGTGTGGGGGTGG + Intergenic
1167791790 19:51688019-51688041 CTGAGGCTGTGTGGAGTGGAGGG - Intergenic
1168617573 19:57850775-57850797 TTATGGCTGATTGGAGGGGGAGG + Intronic
924999312 2:392429-392451 CTGTGGCTGGTGGAGGTGGGAGG + Intergenic
925154422 2:1638800-1638822 CTGTGGAATCTTGGAGTGGGGGG + Intronic
926329926 2:11815868-11815890 CTCTGGCCCCTTGGAGTTGGAGG + Intronic
927024431 2:19050874-19050896 CTGAGGCTTCATGAAGTGGGAGG + Intergenic
927709168 2:25314492-25314514 CAGGGGCTGGTTGGGGTGGGAGG - Intronic
927912971 2:26914663-26914685 CAGTGGCTGCTGGCAGTGTGGGG + Intronic
928372250 2:30748655-30748677 CTCTAGCTGCTTGCAGTAGGAGG + Intronic
928495958 2:31832159-31832181 CTCTGGGTGCTTGGAATCGGAGG + Intergenic
929501253 2:42493546-42493568 GCGTGGCGGCTTGGGGTGGGGGG - Exonic
929839409 2:45441890-45441912 ATTTGGCAGCTTGGAGTGGGAGG - Intronic
930753818 2:54956379-54956401 CTTTTACTACTTGGAGTGGGAGG + Intronic
931848582 2:66230406-66230428 AAGTAGCTGCTTGGAGGGGGAGG + Intergenic
932331857 2:70902156-70902178 CTGCGGCTGCTGGGTGTGGGTGG + Intronic
932376947 2:71245006-71245028 CTGTGGCTGTGTGTGGTGGGGGG - Intergenic
932819262 2:74885677-74885699 GTGTGGCTGCATGGGTTGGGAGG + Intronic
936233447 2:110724367-110724389 CTGTGGCTGTGTGGAGGGGAGGG + Intergenic
936249009 2:110852947-110852969 ATGTGGGTGCTTGGAGCGGAAGG + Intronic
937384567 2:121416654-121416676 CTGAGGCTTCTTGGGGTCGGGGG - Intronic
938946181 2:136213967-136213989 CAGTGGCTGCCTGGAGTGCTGGG + Intergenic
939991070 2:148876651-148876673 CTGGGGCTGCTGGTAGGGGGAGG + Intronic
940887229 2:159000420-159000442 CAGTGGTTGCGGGGAGTGGGAGG + Intronic
942020145 2:171859662-171859684 CAGGGGCTGGTTGGAGTGGAAGG + Intronic
942044399 2:172090914-172090936 GTGGGGCTGCTGGGGGTGGGGGG + Intergenic
942135103 2:172917530-172917552 CTGTGGCTGCCTGAATTGTGTGG - Intronic
942458046 2:176151247-176151269 CTGTGCCTACTTGGTGTCGGGGG + Exonic
945798521 2:214394877-214394899 CTGTGGCTGCCAGGAGTTGTGGG - Intronic
946089180 2:217205821-217205843 CTGTGGTTGCATGGAATTGGAGG - Intergenic
946179819 2:217942602-217942624 CTGAAGCTGCCTGGGGTGGGTGG - Intronic
946804049 2:223452074-223452096 CAGGGGCAGCTTGGAGTGGGCGG + Intergenic
948113528 2:235476489-235476511 CTGTGGCTACTAGAAGGGGGAGG + Intergenic
1169192821 20:3668790-3668812 CTCTGGGTTCCTGGAGTGGGTGG + Exonic
1169519849 20:6359321-6359343 GTGTGGCTGCTGGGATTGGCTGG - Intergenic
1169800298 20:9506921-9506943 CTGTGCCTGCAGGGAGAGGGTGG - Intergenic
1169840667 20:9933271-9933293 CTGTGGCAGAGTGGAGTGGACGG + Intergenic
1170031418 20:11948051-11948073 CTGTGGCTGTGTTGAATGGGAGG - Intergenic
1170740263 20:19049803-19049825 GTGTGGCTTGCTGGAGTGGGAGG + Intergenic
1172884305 20:38221166-38221188 CTCTGCCTGCCTGGAGAGGGAGG + Intronic
1173458473 20:43222843-43222865 CTGTGGAAGATGGGAGTGGGTGG - Intergenic
1173864358 20:46304908-46304930 CTGTGCCTGCCTGGAGGAGGGGG - Intronic
1174047091 20:47741262-47741284 CTGTGGCTGCAGAGAGTGGGCGG - Intronic
1174831809 20:53820383-53820405 CTGTGGGTCCGTGGAGTTGGCGG - Intergenic
1175280368 20:57800206-57800228 CTGTGGCTGCTTGTAGTAATAGG + Intergenic
1175411951 20:58776309-58776331 CTCTGCCTGCTCGGGGTGGGTGG + Intergenic
1176101070 20:63364825-63364847 CAGTGGCAGCCTGGAGTTGGTGG - Intronic
1176110080 20:63407100-63407122 CTGTGGCTGCCAGGAGGTGGAGG + Exonic
1176124557 20:63469701-63469723 CTGGGGCAGCCGGGAGTGGGGGG - Intronic
1176205879 20:63887869-63887891 CCCTGGCTGCCTGCAGTGGGTGG + Intronic
1176373083 21:6074231-6074253 CTTTGGCTGCTAGGACTGGTGGG + Intergenic
1176961930 21:15168760-15168782 CTGTGGCCTGTTGGAGGGGGAGG + Intergenic
1177260629 21:18725157-18725179 GTCCTGCTGCTTGGAGTGGGAGG - Intergenic
1177918750 21:27124234-27124256 CTGAGGCTGCATAGAGTAGGAGG + Intergenic
1178000918 21:28161643-28161665 CTCTGGCTGGCAGGAGTGGGAGG - Intergenic
1178151940 21:29805140-29805162 CTGTGGCTGCAGGGGGTGGAGGG - Intronic
1179360957 21:40708403-40708425 CTGTGCCTGCTTGGGATGGGAGG - Intronic
1179363899 21:40738020-40738042 CTGTGGCTCCTACTAGTGGGAGG + Intronic
1179750394 21:43464012-43464034 CTTTGGCTGCTAGGACTGGTGGG - Intergenic
1180105584 21:45616358-45616380 CTGGGGCTGCTGGGAGGTGGGGG - Intergenic
1181235712 22:21446730-21446752 CTTTGGCTTCTAGGAGGGGGAGG - Exonic
1181266876 22:21635631-21635653 CAGTGGCTGCTAGGAGTGGTGGG - Intronic
1183121952 22:35736936-35736958 ACGTGCCAGCTTGGAGTGGGTGG + Intergenic
1183365963 22:37406946-37406968 CTGTGGCTGCCTGGAGGATGGGG - Intronic
1183383545 22:37502576-37502598 CTGTAGCTGCCTGCAGTGGGTGG - Intronic
1183391024 22:37545831-37545853 CTGGGGCTGCCTGGAGGGGGAGG + Intergenic
1183620921 22:38972074-38972096 TTGTGGCTGTTGGGAATGGGTGG - Intronic
1184256856 22:43291991-43292013 CTGTGTCTTCCTAGAGTGGGGGG - Intronic
1184724857 22:46337983-46338005 CTGTGGATCCTTGCAGTGGAAGG + Intronic
1184915272 22:47564535-47564557 CAGTTGCTGCTTTCAGTGGGAGG + Intergenic
1185130701 22:49037258-49037280 GTGAGGATGCTGGGAGTGGGAGG + Intergenic
1185130730 22:49037349-49037371 GTGAGGATGCTGGGAGTGGGAGG + Intergenic
1185130759 22:49037440-49037462 GTGAGGATGCTGGGAGTGGGAGG + Intergenic
1185176148 22:49328160-49328182 CTGGGGCTCCTTGGAGTCTGTGG - Intergenic
1185409069 22:50673334-50673356 CTGGGGCTGCTTGGGGGCGGAGG + Intergenic
949384819 3:3489526-3489548 CTGTAGCTGCTAGGGGTTGGAGG - Intergenic
950041803 3:9924402-9924424 CTGTGGCTCCCTGGGGTGGCTGG + Intronic
950172721 3:10850810-10850832 CTGTGGCTGCTTGTTGTGAATGG + Intronic
950453472 3:13078797-13078819 CTGGGGCAGCTGGGAGAGGGAGG - Intergenic
950836543 3:15925142-15925164 CTGTGCCTGCATACAGTGGGTGG - Intergenic
952141130 3:30480331-30480353 CTGAGGCTGCATGGAGCAGGGGG - Intergenic
952787707 3:37172452-37172474 ATATGGTTGCTTGGATTGGGGGG + Intronic
953032101 3:39185890-39185912 CTGGGCCTCCCTGGAGTGGGCGG + Exonic
953119298 3:40024254-40024276 CTGTGGCTGATTTGAGAAGGTGG + Intronic
953276712 3:41508255-41508277 CTGTGGCTGCTGTGAGGGGTGGG - Intronic
953390760 3:42532410-42532432 CTCTGGATGTTTGGGGTGGGAGG - Intronic
953914297 3:46908838-46908860 TTGTGGCTGTGTGGAGTGTGTGG + Intergenic
954455798 3:50599249-50599271 CTGGGGCAGCTGGCAGTGGGTGG - Intergenic
954746994 3:52793024-52793046 CTGTGGCTGCTGGCACTGGGTGG - Intergenic
955784933 3:62527439-62527461 CTGTGTGTGCTGGGGGTGGGGGG + Intronic
956975042 3:74569298-74569320 CGATGGCTGATTGGTGTGGGAGG + Intergenic
957563898 3:81860693-81860715 ATGTGGCTGCTAGGAGTTGCTGG - Intergenic
957952213 3:87141535-87141557 CTGTGGCTCCCTGGGGTTGGGGG + Intergenic
958894606 3:99815971-99815993 CTTTGGCAGGCTGGAGTGGGAGG + Intergenic
961190446 3:124956733-124956755 CTTTGGCAGCCTGCAGTGGGTGG - Intergenic
961507096 3:127377280-127377302 CTGGGGCTGCAAGGGGTGGGGGG + Intergenic
961579487 3:127867645-127867667 AAGTGGTTGCTTGGAGTGGGAGG - Intergenic
961779521 3:129313564-129313586 CTGTGGCTGTTTGGGGTCTGGGG - Intergenic
962311252 3:134328506-134328528 CTGTGGCTGCTCTGAGAGTGAGG - Intergenic
962434649 3:135355208-135355230 CTGCAGCAGCTTGGAGAGGGTGG + Intergenic
962853949 3:139328019-139328041 GTGTGTGTGCTGGGAGTGGGAGG + Intronic
965795954 3:172438850-172438872 CTGTGGGTGTGTGGAGTGGGGGG - Intergenic
966234634 3:177686890-177686912 CTGTGCCTGCTTGGCGCGGAAGG - Intergenic
966301633 3:178485602-178485624 CTCTGTGTGCTTGGAGTTGGGGG - Intronic
968017725 3:195353994-195354016 CTGTGGCTTATTGGAGTGGGAGG - Intronic
968614700 4:1572126-1572148 CTGTGGCTGCCAGGCGTTGGTGG - Intergenic
968820796 4:2849556-2849578 CTGTGGCTGTTTGCATGGGGAGG + Intronic
969279260 4:6158615-6158637 CTGGGGCTGGTGGGGGTGGGGGG - Intronic
970211062 4:13710467-13710489 TAGTGGGTACTTGGAGTGGGTGG + Intergenic
970312645 4:14798599-14798621 CCATGGCTGCTTTCAGTGGGTGG + Intergenic
972091757 4:35295199-35295221 GTGTGTCTGCTGGGGGTGGGTGG + Intergenic
974187996 4:58465203-58465225 AGCTGGCTGCTTGGAGTGTGGGG - Intergenic
978497487 4:109375989-109376011 GAGTGGCTCCTTGGAGTGGGAGG - Intergenic
979297672 4:119051965-119051987 ATGTGTGTGTTTGGAGTGGGTGG + Intronic
980557699 4:134430818-134430840 CTGTGGCTGCTTACACAGGGTGG + Intergenic
986791687 5:11167180-11167202 CTGAGGCTGATAGGCGTGGGAGG + Intronic
987737072 5:21859946-21859968 TTGTGTCTGCCTGGATTGGGTGG - Intronic
988540456 5:32103823-32103845 CTGTGGCTTCTTCTAGTGTGGGG - Intronic
988604649 5:32668842-32668864 CTGTGGCTGTTTGGATGGGGAGG + Intergenic
988707471 5:33740448-33740470 CTGTGGTGGGTTGGAGTGGTGGG - Intronic
988993229 5:36691211-36691233 AAGAGGTTGCTTGGAGTGGGGGG + Intergenic
990475930 5:56161947-56161969 CTGTGGCTGCTTTGTGAGTGGGG + Intronic
990775383 5:59300683-59300705 TGTTGGCTGCTTGGTGTGGGGGG - Intronic
992842211 5:80707041-80707063 CAGTAGTTGCTTGGAGTGGGAGG - Intronic
993106397 5:83605584-83605606 CTGTGTTTGGTTGGGGTGGGTGG + Intergenic
994489390 5:100422484-100422506 CTGTGGAGGCTTTGAGTGGAAGG + Intergenic
994777278 5:104050137-104050159 TTGTCGGTGCTTGGAGTGGCTGG + Intergenic
995443410 5:112217009-112217031 CTGTGGTTGCAGTGAGTGGGTGG - Intronic
996416711 5:123218428-123218450 CTGTGGCTTCTTGCAGAAGGAGG - Intergenic
997364894 5:133319405-133319427 CTGTGGGTGCCTGTGGTGGGAGG + Intronic
997654546 5:135545414-135545436 CTGTGGCTGCCTGGGGATGGCGG + Intergenic
998350315 5:141496164-141496186 CTGGGGCTGCTTGGATGGGAGGG - Intronic
998361224 5:141589628-141589650 CAGTGGTTACTTGGGGTGGGTGG + Intronic
998383470 5:141742328-141742350 CTGAGGCTGGGTGGGGTGGGGGG + Intergenic
999498563 5:152124509-152124531 CTGTGGCTGAGTGATGTGGGAGG + Intergenic
1000040963 5:157484918-157484940 CTGTGGCTGGTTGCCCTGGGAGG - Intronic
1000114797 5:158143604-158143626 GTGTGGCTATTTGGAATGGGAGG - Intergenic
1000518945 5:162275607-162275629 CTCTGGCGGGCTGGAGTGGGGGG + Intergenic
1002255070 5:177952534-177952556 CAGTGGCTGCTTGGGATGGGGGG - Intergenic
1002483013 5:179515874-179515896 CAGTGGCTGCTTGGGATGGGGGG + Intergenic
1002613260 5:180435299-180435321 GGGTAGATGCTTGGAGTGGGAGG + Intergenic
1003494748 6:6654094-6654116 GTGGGGCTGCAGGGAGTGGGGGG - Intronic
1003809003 6:9758883-9758905 CTGCTGCTCTTTGGAGTGGGTGG - Intronic
1004163204 6:13232748-13232770 CTGAGGGTGGTTGGGGTGGGTGG + Intronic
1005239774 6:23810288-23810310 CTGGGGCTGCTGGGGGTTGGGGG + Intergenic
1006008284 6:31020802-31020824 CGCTGGCTGCTTCGAGTGCGGGG - Intronic
1006121676 6:31810689-31810711 CTGTGTCTGCTTGGTGGGGATGG + Exonic
1006409644 6:33865178-33865200 GTGTTGGTGCTTGGAGTGGCCGG + Intergenic
1006628195 6:35412467-35412489 CTGTGACTGCATGGAGCAGGAGG + Intronic
1007119854 6:39370813-39370835 GTGTGGGTGCTGGGGGTGGGGGG + Intronic
1007874201 6:45077381-45077403 CTTTGGCAGGTTGAAGTGGGAGG + Intronic
1008245779 6:49171203-49171225 CTGTGGCTTCTAGGATTAGGTGG - Intergenic
1008593126 6:53013665-53013687 CTGTGGATGCTTGTTGTGGAGGG + Exonic
1011785950 6:90845275-90845297 CTGTGTCTGATTCGACTGGGTGG + Intergenic
1012090253 6:94883858-94883880 CTGTGGCTGCTAAGAGTTAGTGG - Intergenic
1012858232 6:104528203-104528225 CTGTGCCTGCTTGGATTGGTTGG - Intergenic
1013276354 6:108588772-108588794 CTGTTGAGGCTTGGAGTGAGAGG - Intronic
1017190486 6:151648364-151648386 CTGTGGCTGCTGTGAGGGGATGG + Intergenic
1017709735 6:157156800-157156822 CGGAGGCAGCATGGAGTGGGAGG + Intronic
1017718715 6:157229941-157229963 GTGTGGCTGGGTGGAGTGGCTGG + Intergenic
1017806790 6:157953236-157953258 CTCTGGCTGCCTAGAGTGGCGGG - Intergenic
1018390310 6:163336517-163336539 CTGTGGCTGCTGGGGGTGGGAGG - Intergenic
1018790319 6:167143320-167143342 CTGTAGCTGGTTAGAGTGAGCGG - Intergenic
1019357276 7:587263-587285 CTGTGAGTGATTGGAGTGGATGG - Intronic
1019527599 7:1487694-1487716 CTGTGGGTGGTTGGTGTGGGTGG - Intronic
1020040431 7:4997044-4997066 CTGTGGCTGCCTGTAGGAGGCGG + Intronic
1020127057 7:5538975-5538997 CTGTGGGCGCTTGGAGGGGGAGG + Intronic
1020498525 7:8887729-8887751 CTCTGACTGCTGGGACTGGGAGG + Intergenic
1021113082 7:16717740-16717762 CTGGGGCTTGTTGGGGTGGGGGG + Intergenic
1021458181 7:20853247-20853269 CTGTGCCTGCAAGAAGTGGGGGG - Intergenic
1021980513 7:26050109-26050131 CAGTGGTTGCTAGGGGTGGGGGG - Intergenic
1022050122 7:26658836-26658858 CTGTTCCTACTTGGAGTTGGTGG - Intergenic
1022088147 7:27088439-27088461 CTGGGGCTGCGGGGAGCGGGCGG - Intergenic
1022180113 7:27910858-27910880 CAGTGGATACTTGGGGTGGGGGG - Intronic
1022780925 7:33582340-33582362 ATGGGGCTGCTTGGAAGGGGTGG + Intronic
1023991291 7:45130272-45130294 CATTTGCTGCTGGGAGTGGGAGG - Intergenic
1025144171 7:56490605-56490627 CTGGGGCTGCTGGGATTGTGGGG + Intergenic
1025812352 7:64883217-64883239 CAGTTGCTGCTTGGTGAGGGGGG - Intronic
1025981426 7:66410452-66410474 CTGTGGCTGCCTGGAGGTAGGGG - Intronic
1026413487 7:70153399-70153421 CAGTGGTTGCTTGGAGAGGCAGG + Intronic
1026596833 7:71739904-71739926 CTGTGGCTGCTGGTGTTGGGAGG - Intergenic
1028994919 7:97089783-97089805 CTGTGGCTGCTCAGCCTGGGTGG - Intergenic
1029151827 7:98485716-98485738 ATGTAGCTACATGGAGTGGGTGG + Intergenic
1029215531 7:98946293-98946315 TTGTGCCTGCTAGAAGTGGGAGG + Intronic
1030197168 7:106863774-106863796 CTGGGGGTGGGTGGAGTGGGAGG - Intergenic
1031981575 7:128130239-128130261 ATGTGGTTGCTTGGACTGGAGGG + Intergenic
1032325223 7:130921779-130921801 CTGTGGCCGCTGCGAGTCGGCGG + Intergenic
1032446579 7:131989373-131989395 CAGGGGCTGCTGGGAGAGGGGGG + Intergenic
1033152173 7:138924992-138925014 CGCTGGCTACTTGGAGTGGGTGG - Intronic
1033499720 7:141935763-141935785 CTGAGGCTGTGTGGAGTGTGTGG + Intronic
1034388651 7:150764197-150764219 CCGTGGTTGCCTGGAGTTGGGGG + Intergenic
1034417183 7:150971355-150971377 CTGCGGCTGTTGGGAGGGGGTGG - Intronic
1034564631 7:151903619-151903641 CTTGTGCTGCTTGGAGTGTGTGG + Intergenic
1035307923 7:157945248-157945270 ATGTGGCTGCTGCGAATGGGTGG - Intronic
1035351738 7:158252161-158252183 CCTCAGCTGCTTGGAGTGGGTGG + Intronic
1035413575 7:158666015-158666037 CTGTGGCTGCTTGAAGTACTGGG - Intronic
1035476714 7:159149174-159149196 GTGTGCCTGCCTGGGGTGGGAGG - Intergenic
1036629614 8:10501787-10501809 CAGTGGCTGCCAGGAGTTGGGGG + Intergenic
1036662300 8:10716172-10716194 CTGTGGCTGCTGGGACAGGGCGG + Intergenic
1036730002 8:11254256-11254278 CTCAGGCTGCATGGGGTGGGTGG + Intergenic
1038437110 8:27543971-27543993 CGGTTGCTGCTTGCAATGGGGGG - Intronic
1038536502 8:28356911-28356933 CACTGGCTGATTGGAGTTGGGGG - Intronic
1039677679 8:39687624-39687646 CTGGGACTGCTTGAAATGGGAGG - Intronic
1040739902 8:50560704-50560726 CTGTGGCTGGTTGTTGTTGGAGG + Intronic
1042493101 8:69424332-69424354 CTGTAGTTGTTTGGAGTGGGAGG + Intergenic
1042499456 8:69492509-69492531 CTGTGGCAGGATGGAGTGGATGG - Intronic
1046801061 8:118427463-118427485 CAGTGGTTGCCTGGAGTAGGGGG - Intronic
1047376261 8:124300428-124300450 CTGTGGCTGCTTTTAGTTTGGGG - Intergenic
1047448909 8:124944935-124944957 CTGTGGCTTCTTGGAGAAAGAGG - Intergenic
1048315414 8:133358278-133358300 CTGGGGCTGCTTGGAGGAAGAGG - Intergenic
1048345409 8:133571591-133571613 CTGTGGATTCTCGGAGTGGAAGG - Intronic
1048728727 8:137413653-137413675 CTCTGGCTGGCAGGAGTGGGGGG + Intergenic
1049214660 8:141402163-141402185 CTGAGGCTGCAAGGTGTGGGTGG + Intronic
1049337899 8:142096250-142096272 CAGAGGCTGCCTGGAGAGGGCGG - Intergenic
1049347219 8:142145474-142145496 CTGTGAGTGCTTAGAGTGGGTGG - Intergenic
1049393631 8:142385281-142385303 CTGTGGCTTCTTGGCTTGCGGGG - Intronic
1049580564 8:143408757-143408779 CTGTGGCTGCTTGGAGAGGCCGG + Intergenic
1049798642 8:144507703-144507725 CTTCGGCTGGGTGGAGTGGGAGG + Intergenic
1049867612 8:144949158-144949180 CTGTGGCTGCTTGCTATGGGAGG - Intronic
1049904865 9:206881-206903 CTGTGGCTGCTTGGAGTCATGGG + Intergenic
1050470347 9:5982221-5982243 TTGTAGCTGCTTGCAGTAGGAGG - Intronic
1050773640 9:9234325-9234347 CTGAGGATGCATAGAGTGGGCGG + Intronic
1052559949 9:30072289-30072311 CTGTGGCTTGCTGGAGTGTGAGG + Intergenic
1053598357 9:39585854-39585876 CTGTGGCTGCCTGGAAAGTGTGG - Intergenic
1053856390 9:42342863-42342885 CTGTGGCTGCCTGGAAAGTGTGG - Intergenic
1055027483 9:71737612-71737634 CTTTGGGAGCTTGAAGTGGGAGG - Intronic
1056781073 9:89551539-89551561 CTGTGTGTGCGTGGGGTGGGGGG - Intergenic
1058054076 9:100432165-100432187 ACATGGCTGCCTGGAGTGGGTGG + Intronic
1058968895 9:110062247-110062269 CTGGGGCCTCTTGGAGGGGGTGG - Intronic
1060390016 9:123269074-123269096 GTGTGGCTGCTGGGGTTGGGGGG - Intergenic
1061011759 9:127960119-127960141 GTGTGGCTGCTTCAGGTGGGGGG + Intronic
1061134865 9:128727985-128728007 CTGTGGGTGGCTGGAGTGGGAGG + Intergenic
1061230268 9:129311921-129311943 CTGTGGCTGCTGTTGGTGGGTGG + Intergenic
1061692958 9:132349296-132349318 CTGCTACTGCTTGGAGTGTGTGG - Exonic
1062030380 9:134359533-134359555 CTTTGCCTGCTTGGAGGGTGAGG + Intronic
1062227896 9:135464121-135464143 CTGTGGCTGGTGGGAAAGGGAGG - Intergenic
1186309361 X:8301325-8301347 CTCTGGCTGCTTGGAGAAGTTGG + Intergenic
1187740701 X:22352437-22352459 CTGGTACTGCTTGGAGTTGGGGG - Intergenic
1187748019 X:22430918-22430940 CTTTGGCTGCTTGGTTTGTGGGG - Intergenic
1188224975 X:27586165-27586187 TTGTCACTACTTGGAGTGGGGGG - Intergenic
1189140077 X:38594843-38594865 TTGTGCATGCATGGAGTGGGTGG + Intronic
1189321610 X:40090579-40090601 CTGTGGCCACCTGGAGAGGGCGG + Intronic
1190318119 X:49164063-49164085 CGGAGGGTGCTTCGAGTGGGAGG + Intronic
1190333505 X:49249592-49249614 GTGGGGCTGCTGGGGGTGGGTGG + Intronic
1190808479 X:53861712-53861734 CAGTGGCTGCAAGGAGTGGAGGG - Intergenic
1192185415 X:68943725-68943747 CTGTGGCAGCTTGGAGTGTTAGG - Intergenic
1192487481 X:71541807-71541829 TTGTGGCTGGTGGGGGTGGGAGG + Intronic
1192691748 X:73372572-73372594 CAGTGGTTGGTGGGAGTGGGGGG + Intergenic
1193040218 X:76996921-76996943 CTGGGGCTGCTCTGAGTGTGGGG + Intergenic
1193420804 X:81280146-81280168 CTGTGGCTGCTGTGAGGGGTGGG - Intronic
1196020321 X:110984474-110984496 CTGAGGCAGCTGGAAGTGGGAGG - Intronic
1197738551 X:129871550-129871572 CTGTCGCTGCTTGAACTGGGTGG - Intergenic
1198791786 X:140354349-140354371 CTGTGTCTGTGGGGAGTGGGGGG - Intergenic
1198872322 X:141188778-141188800 CTGGGGCTGCTCCGAGTGCGGGG + Intergenic
1199069145 X:143456439-143456461 CTGTGGCTCTGAGGAGTGGGGGG - Intergenic
1199756609 X:150870762-150870784 CTGGGGCTGCTAGGATGGGGGGG - Intronic
1199786580 X:151111873-151111895 CAGTGGCAGCTAGCAGTGGGGGG + Intergenic
1201918163 Y:19204941-19204963 ATCTGGCTGCTAAGAGTGGGAGG - Intergenic