ID: 1077523520

View in Genome Browser
Species Human (GRCh38)
Location 11:3050324-3050346
Sequence TGCCTGTGGCTGCTTGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 279}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077523520_1077523524 -4 Left 1077523520 11:3050324-3050346 CCCACTCCAAGCAGCCACAGGCA 0: 1
1: 0
2: 0
3: 35
4: 279
Right 1077523524 11:3050343-3050365 GGCACCCAGAAGCAAAGCTCTGG 0: 1
1: 0
2: 3
3: 34
4: 532
1077523520_1077523528 19 Left 1077523520 11:3050324-3050346 CCCACTCCAAGCAGCCACAGGCA 0: 1
1: 0
2: 0
3: 35
4: 279
Right 1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG 0: 1
1: 0
2: 1
3: 3
4: 87
1077523520_1077523525 -3 Left 1077523520 11:3050324-3050346 CCCACTCCAAGCAGCCACAGGCA 0: 1
1: 0
2: 0
3: 35
4: 279
Right 1077523525 11:3050344-3050366 GCACCCAGAAGCAAAGCTCTGGG 0: 1
1: 0
2: 3
3: 23
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077523520 Original CRISPR TGCCTGTGGCTGCTTGGAGT GGG (reversed) Intronic
900179308 1:1304332-1304354 TGCCTCTGCCTGCCTGGGGTTGG - Intronic
900379648 1:2377533-2377555 TGCCCCAGGCTGCTTGGAGTGGG - Intronic
900529711 1:3146987-3147009 TGCATGTGTGTGCTTGGTGTGGG + Intronic
900897676 1:5495255-5495277 TGCCAGTGGCTGTCTTGAGTTGG + Intergenic
901636511 1:10672945-10672967 TGCCTGTGAGTGTTTGGAGGTGG + Intronic
901889625 1:12251551-12251573 TGGCTGTGGCTGCTTGGGGCTGG + Intronic
901974384 1:12932650-12932672 TGCTTGTGGCAGCCTGGGGTGGG - Intronic
902010788 1:13269118-13269140 TGCTTGTGGCAGCCTGGGGTGGG + Intergenic
902067370 1:13699801-13699823 TGCGTCTGTCTGCCTGGAGTTGG + Intergenic
902086692 1:13868343-13868365 GTCCTGTGGCTGGTTGGAGGAGG + Intergenic
905486537 1:38301210-38301232 TGCATGTGGCTGCTGGGAAACGG + Intergenic
906118120 1:43368621-43368643 TGACTGTGGCTGAATGTAGTAGG + Intergenic
906476372 1:46172033-46172055 TGCCTGAGGCTGGCTGGAGCGGG + Intronic
906847617 1:49210658-49210680 TGCCTGTGGCTGTTGGGGGTTGG - Intronic
907513276 1:54978196-54978218 AGACTGTGGATGCTTGGAGCTGG + Intergenic
910165920 1:84327423-84327445 TGCCTCTGGCTGCGTGGGGGTGG + Intronic
911877722 1:103190092-103190114 TGTCTGTGGCTTCTTTGTGTAGG - Intergenic
912002987 1:104857950-104857972 GGCCTGTGGCTGCTTTGTTTTGG - Intergenic
912051984 1:105541448-105541470 GGCCTGTGGCTGCTTTGTTTTGG - Intergenic
916424951 1:164671475-164671497 TGCATGTGCCTGCCTGGAGCTGG + Intronic
916686443 1:167151636-167151658 TGCCTGTGGCTCCCTAGAGTAGG + Intergenic
919733301 1:200928417-200928439 TGTCAGTGAGTGCTTGGAGTGGG + Intergenic
920493813 1:206439807-206439829 TCCCTGTTGCTCCTTGGAGTAGG - Intronic
920942423 1:210496250-210496272 TGCCTGTGGCTGTTGGCAGGAGG + Intronic
923208573 1:231782059-231782081 TTCCTGTAGCTGCTTTCAGTGGG + Intronic
923652688 1:235888857-235888879 TGCCAGGGGCTGCTGGGAGAAGG + Intergenic
923867073 1:237950879-237950901 TTCCTGTGGCTGCTAAGAGAAGG + Intergenic
924458986 1:244241455-244241477 TGCCTCTGGCCCCTTGGACTAGG + Intergenic
1063556554 10:7085750-7085772 TGCCTGTGCCTGCATGGGGGAGG + Intergenic
1065870113 10:29949015-29949037 TGCCTGTGGCTGGTTTCATTTGG - Intergenic
1066279933 10:33906560-33906582 TGCCTGTTGGTGCTTGGGTTGGG + Intergenic
1067462021 10:46465296-46465318 TGCCTGGGGCTGCTGGGCTTGGG + Intronic
1067625174 10:47919302-47919324 TGCCTGGGGCTGCTGGGCTTGGG - Intergenic
1067732498 10:48822112-48822134 TTCCTGTGGCTTTTTGGAGGAGG - Intronic
1069815293 10:71190115-71190137 TGCCTGATACTGCTTGGAGAAGG - Intergenic
1070720725 10:78755173-78755195 TGCCTGCCCCTGCTTGGGGTGGG + Intergenic
1073183423 10:101600776-101600798 GGCCAGTGGCAGCTTGAAGTAGG + Exonic
1074765022 10:116694328-116694350 TGCCAGGGGCTGGCTGGAGTTGG - Intronic
1074818722 10:117163617-117163639 GGCCTGGGGCCGCTTGGACTCGG + Intergenic
1075428637 10:122362635-122362657 CTCCAGTGGCAGCTTGGAGTGGG + Intergenic
1076019993 10:127064897-127064919 TGCCAGGGGCTGCAGGGAGTTGG - Intronic
1076315847 10:129540937-129540959 TGACAGTGGCTGCTGGGATTTGG + Intronic
1076649659 10:131979085-131979107 TGCCTGAGGCTGCGTGCAATAGG - Intronic
1076805929 10:132858721-132858743 TGCCTGTGGCTGGTGGGGGTGGG + Intronic
1077120949 11:908233-908255 TGCCTGTGGCTCCATGTACTGGG - Intronic
1077375606 11:2203962-2203984 AGCCTGTGTCTGCTGGGACTGGG + Intergenic
1077403557 11:2370801-2370823 TGCCTGGGGCTTCGTGGACTGGG - Intergenic
1077523520 11:3050324-3050346 TGCCTGTGGCTGCTTGGAGTGGG - Intronic
1077740306 11:4838976-4838998 TGTCTCTGGGTGCTTGGAGAGGG + Intronic
1078150625 11:8756726-8756748 GGCCTGGGGCTGCTTGTAGGAGG - Intronic
1079184671 11:18226111-18226133 TGCCTCTGGCTGCTGTGAGATGG - Intronic
1080639300 11:34149476-34149498 TGCCTGTGGCTGCTCATAGCAGG + Intergenic
1080776619 11:35392780-35392802 TGCATGTGTATGCTTGGAGAGGG + Intronic
1081687532 11:45053372-45053394 TGGCTGTGGCAGCTGGGAGTGGG - Intergenic
1082643769 11:55696699-55696721 TTCCTGTTGCTGCTTGCATTTGG - Intergenic
1083898063 11:65630155-65630177 TGCCCTTGGATGCTGGGAGTTGG + Intronic
1083966549 11:66047181-66047203 TGGCTGGGGCTGCTTGCAGGAGG + Intronic
1087261385 11:96016380-96016402 TTCCTGTGGCTGCTAGGAGCAGG - Intronic
1088647319 11:111927235-111927257 TGGCTCTGGCTGGCTGGAGTCGG + Exonic
1089334499 11:117713780-117713802 AGCCTGTGGCTGTGTGGAGGTGG + Intronic
1089557780 11:119324287-119324309 TGCAGGGGGCTGCTAGGAGTTGG + Intergenic
1091664591 12:2410156-2410178 TCCCTCTGGCAGATTGGAGTGGG - Intronic
1092912442 12:13159096-13159118 TGTCTGTGACTGCTGGGAGGGGG + Intergenic
1095799446 12:46257005-46257027 TGCCTGTGGCAGGGTGGAGAAGG + Intronic
1096626016 12:52896494-52896516 TGGCTGTGACTGAGTGGAGTGGG + Intergenic
1097180415 12:57168655-57168677 TGCCTGTGGCTGGCAAGAGTGGG - Intronic
1100162065 12:91872052-91872074 TGCCCTTGACTGCTTGGACTTGG - Intergenic
1100514742 12:95316490-95316512 TGCCTGTGGCTGGTGGGACCTGG - Intergenic
1100885816 12:99068789-99068811 TGCCTGTGCCTGCTAGGACTAGG - Intronic
1101982978 12:109423594-109423616 TTCCAGTGGCTGCTGGGAGGGGG - Intronic
1103223674 12:119267862-119267884 GGCCTGTAGCTGCTTGGTTTTGG + Intergenic
1103579303 12:121902572-121902594 TGCCTGTGGCTGCTTGTCTGGGG + Intronic
1103950903 12:124550473-124550495 TGCCAGTGGCTGCTGGGGGAAGG - Intronic
1104169381 12:126265331-126265353 TGCCTGGGGCTGCTTAGAACTGG + Intergenic
1104685360 12:130781135-130781157 AGCCTGTGGCTGCTCGGTGTGGG + Intergenic
1104915510 12:132262396-132262418 TGCCTGTGGCTGGGTTGAGTTGG - Intronic
1105837485 13:24223909-24223931 TGACTGAGGCTGCCTGGAGGAGG + Exonic
1106483495 13:30154225-30154247 TGCATCTGGCTGCCTGGGGTGGG - Intergenic
1107292198 13:38867652-38867674 GGCCTTTGGCCTCTTGGAGTGGG - Intronic
1107957049 13:45525117-45525139 TTACTGTGACAGCTTGGAGTTGG + Intronic
1108936337 13:55885757-55885779 TGTCTGGGGCAGCTTGGAGCAGG - Intergenic
1109653053 13:65353731-65353753 TGCCTGTGGCTGTAGGGATTGGG - Intergenic
1111618295 13:90690099-90690121 TGCCTGGGGCTGCTTGGTATTGG + Intergenic
1113519989 13:110933747-110933769 TATCTGTGCCTGCATGGAGTGGG + Intergenic
1115405401 14:33009837-33009859 TGTCTGCGCCTGCTTGGTGTTGG - Intronic
1118762669 14:68890253-68890275 TGCCTGGGGCTGCCTGGAGCAGG - Exonic
1118895586 14:69942992-69943014 TCCCTGTGGCTGCTGGTGGTGGG + Intronic
1119481917 14:74963289-74963311 GGCCTGAGGCTTCTTGGAGAAGG + Intergenic
1119640462 14:76310612-76310634 TGCATGGGGCTGGGTGGAGTTGG + Intronic
1121434755 14:93911662-93911684 TGCCTGTGACTGCTTGAGCTGGG + Intergenic
1122210441 14:100170383-100170405 TGCCTTTGGCTGTTGGGTGTGGG - Intergenic
1122269857 14:100564046-100564068 TCCCGGTGACTGCTTGGAGTAGG + Intronic
1123093298 14:105751640-105751662 TGCGTGTGGCTGGTGGGGGTGGG + Intergenic
1123948827 15:25251764-25251786 TTCCAGTGCCTGCTTGGAGTGGG + Intergenic
1125327934 15:38555537-38555559 TGCAAGTGGCTGCTAGGGGTAGG + Intronic
1128089686 15:64911356-64911378 TTGCTGTGGTTGCTGGGAGTTGG - Intronic
1129192771 15:73947103-73947125 TGCCTGTGGCTGCATCCAGTAGG - Exonic
1129367261 15:75063965-75063987 TCTCTGTGCCTGCATGGAGTGGG + Intronic
1130149940 15:81303803-81303825 AGCCTGGGGCTGCGTGGAGAGGG + Intronic
1130819717 15:87481697-87481719 TGCCTGTCTCTGTTTGAAGTGGG - Intergenic
1137300749 16:47145034-47145056 TGCCTGTCTCTGCGTGTAGTAGG + Intergenic
1137610297 16:49813297-49813319 AGGCTCTGGCTGCCTGGAGTCGG - Intronic
1138474724 16:57263982-57264004 TGCCTCTGGCTGCTAGGGTTTGG + Intronic
1139268650 16:65662308-65662330 TGCCTGTGGGTGAATGGAGCTGG - Intergenic
1139914031 16:70417349-70417371 GGCCGGTGCCTGCTGGGAGTGGG - Intronic
1140222443 16:73053749-73053771 AGCCTGTGGCTGCCTGGGGAAGG - Intronic
1140299418 16:73741546-73741568 TGCCCAGAGCTGCTTGGAGTTGG - Intergenic
1141644071 16:85358113-85358135 CGCCTGTGGCTGGCGGGAGTGGG - Intronic
1141713733 16:85715255-85715277 TGTCTGTGGTTGTTTGGGGTAGG - Intronic
1142663410 17:1447174-1447196 TGCCTTTGGCTGTTTGTGGTTGG - Intronic
1142747108 17:1965451-1965473 TACCTGTGGCTGCACAGAGTTGG + Intronic
1143656025 17:8294315-8294337 TGCCTTTCCCTGCTTGCAGTGGG + Intronic
1144527705 17:16004503-16004525 TTTCTGTTGCTGCTTGAAGTGGG + Intronic
1144676800 17:17167218-17167240 TGCCTGTGCCTGCTCTGAGCAGG - Intronic
1147595634 17:41715510-41715532 TGCATCTGGCTGCTGGGAGCGGG - Exonic
1149651690 17:58279942-58279964 TGCCACCGGCTGCTTGAAGTAGG + Exonic
1151310295 17:73288642-73288664 TTCCAGTGGGTGCTTGGAGGCGG - Intronic
1152121837 17:78423608-78423630 TGCCTCTGGCTGCTGGGAATTGG + Intronic
1152189446 17:78879569-78879591 TGCCTCTGGCTCCTTGGGGAAGG - Intronic
1152502837 17:80724666-80724688 AGCCTGTGGTGGGTTGGAGTTGG + Intronic
1154206474 18:12341445-12341467 TGTCTGTGGTTGCCTGGGGTTGG - Intronic
1155925843 18:31653786-31653808 TGTGTGTGGCAGCTTGGAGCAGG - Intronic
1156363960 18:36408631-36408653 TGCCAGTGGTTACTTGGAGCAGG + Intronic
1157216396 18:45787052-45787074 TGCCTTTGGCAGCTTAGGGTGGG - Intergenic
1157222601 18:45838444-45838466 TGCTTGTGGGTGCTTGGACTAGG - Intronic
1160080017 18:75717497-75717519 ATCCTGTGGATGTTTGGAGTGGG - Intergenic
1161051889 19:2168427-2168449 TGTGGGTGGCTGCTTGGAGGAGG + Intronic
1161070190 19:2256107-2256129 GGCCTCTGGCTGCTGGGATTAGG + Intronic
1162813494 19:13179225-13179247 TGCCAGGGGCTGCTGGGAGGGGG - Intergenic
1164000063 19:21090230-21090252 TGCCTGTGGCAGGTTGGGGAAGG + Intronic
1164438684 19:28254708-28254730 TGTCTGTGGGGGGTTGGAGTTGG - Intergenic
1165103729 19:33456513-33456535 TGCCTCAGGTGGCTTGGAGTAGG - Intronic
1165342427 19:35222596-35222618 TGCCTGCAACTGCTTGGGGTAGG + Intergenic
1165436849 19:35800169-35800191 TCCCTATGGCTCCTTGGAGGAGG - Exonic
1166129400 19:40737008-40737030 TGCCTGCGTCTTCTTGAAGTTGG - Exonic
1166405929 19:42521862-42521884 GGCCTCTGGCTGCGTGGATTTGG + Intronic
1166415084 19:42589395-42589417 GGCCTCTGGCTGCGTGGATTTGG + Intronic
1167017272 19:46849475-46849497 AGGCTGTGGCTGCCTGGTGTAGG - Intronic
1167038095 19:47006050-47006072 TGGCAGTGGCTGCCTGGAGAGGG - Intergenic
1168441815 19:56374710-56374732 TGCCTTTGGCTCCTGGGAGATGG - Intergenic
925337497 2:3108854-3108876 TGCCAGTGCCTGCCTGGAGAAGG - Intergenic
926050847 2:9743833-9743855 TCCCTGTGGCTGCTGTGAGGAGG - Intergenic
926210890 2:10868722-10868744 TCTCTGTGGCTGATTGGAGGTGG - Intergenic
926677432 2:15638047-15638069 TGACTTTGCCTGCTTGGGGTTGG + Intergenic
926747206 2:16168665-16168687 TGCCTCTGGCTGCTTTGAAGAGG - Intergenic
927029194 2:19103010-19103032 TGCCAGTGGCTGCTTGCAGAAGG - Intergenic
928089069 2:28363201-28363223 TGCCTGTGGCTGCTGAGAGAAGG - Intergenic
928372248 2:30748652-30748674 GGCCTCTAGCTGCTTGCAGTAGG + Intronic
928919552 2:36512418-36512440 TGCCCCTGGCTGCTTTGAGGGGG - Intronic
929537334 2:42792025-42792047 TGCCTGTGGCTTCTGGGACAGGG + Intronic
929982589 2:46695882-46695904 TGCCAGTGGCAGCATTGAGTAGG + Intergenic
932283108 2:70511950-70511972 TGAGTGTGGCTGGTGGGAGTTGG + Intronic
932495129 2:72142356-72142378 TGCCTGGGGCTGCTGGAAGCTGG - Intronic
933614407 2:84469562-84469584 TGCCTGTGGCAGCGTGGGGAAGG + Intergenic
933813478 2:86047958-86047980 TGACTGGGGATGCTAGGAGTAGG - Intronic
933864637 2:86505059-86505081 TGCCTGTCCCTGCTTCGAGCTGG - Exonic
933865621 2:86514194-86514216 TGCCTGTCCCTGCTTCGAGCTGG - Intronic
934755649 2:96822948-96822970 TGCTCGTGGCTCCTTGGAGCTGG + Intronic
935459253 2:103309537-103309559 TGTCTGTGGTTGCTTGGGCTAGG + Intergenic
936236746 2:110748659-110748681 TGCAGGTGGCTCCTGGGAGTGGG + Intronic
937089688 2:119197661-119197683 TGCATGTAGCTGCTTCGTGTAGG - Intergenic
938065594 2:128280423-128280445 TGCCTGTGCCTCCTGGGAGCGGG - Intronic
938076793 2:128343890-128343912 TGCCTTGGGCCTCTTGGAGTAGG - Intergenic
938983927 2:136554540-136554562 TGGCTGTGCCTGGGTGGAGTGGG - Intergenic
939867209 2:147486052-147486074 TGCCTTTAGCTCCCTGGAGTGGG - Intergenic
941256797 2:163241691-163241713 GGCCTGTGCCTGCCTGGTGTTGG + Intergenic
941722499 2:168826890-168826912 GGTCAGTGGTTGCTTGGAGTTGG - Intronic
942089772 2:172478570-172478592 CCCCTGTGGCTGCTGGGAGCAGG + Intronic
942363988 2:175203226-175203248 TGCCTGTGGCTGATTTAAGTAGG + Intergenic
942889244 2:180967266-180967288 TGCCTGTGACTGCATGAACTTGG - Intronic
944321309 2:198346755-198346777 TGTGTGTGTCTGGTTGGAGTGGG + Intronic
946112448 2:217431839-217431861 TGTCTGTGGCTGATTGAACTGGG - Intronic
948242174 2:236446896-236446918 TGACTGCGGCTGCTGGGCGTGGG + Intronic
1168925570 20:1576158-1576180 TGGCTGTGGCTGCCTGGGCTGGG + Intronic
1169013786 20:2274473-2274495 TGCCTGTGGCAGCTGGGATGGGG + Intergenic
1170499073 20:16956097-16956119 GTGGTGTGGCTGCTTGGAGTTGG + Intergenic
1171067570 20:22033228-22033250 TGACTGAGGCTGCTGTGAGTGGG - Intergenic
1171990712 20:31694277-31694299 TGCTGGTGGCAGCTTGGAGCTGG + Intronic
1173866184 20:46313925-46313947 TGCAGGTGGCTGCGTGGAGATGG + Intergenic
1174705278 20:52648799-52648821 TCCATGTGGCTTCTTGGAGCTGG + Intergenic
1174831812 20:53820386-53820408 TCCCTGTGGGTCCGTGGAGTTGG - Intergenic
1175117061 20:56690061-56690083 TTCCTGTGGCTGCTGGGAGCGGG - Intergenic
1175306101 20:57976634-57976656 TGCGTGTGGCTGGCTGGAGATGG - Intergenic
1175472215 20:59238437-59238459 TGCCTGGGGTTGCTTGGCTTAGG + Intronic
1175527994 20:59648831-59648853 TGCCTGTGGCTACTCCGAGGTGG - Intronic
1176039286 20:63055941-63055963 TGCCAGGGGCAGCTTGGAGCAGG + Intergenic
1176101072 20:63364828-63364850 AGCCAGTGGCAGCCTGGAGTTGG - Intronic
1176774031 21:13113808-13113830 TGCCTATGGCCACTTGAAGTGGG - Intergenic
1179494139 21:41761050-41761072 AGCCTGTGGCTGCAGGGAGAGGG - Intronic
1180089278 21:45525510-45525532 TGCCTGTGGCTGCCGGAACTTGG - Intronic
1181431205 22:22882849-22882871 TGCCTGTCGCTGCTTCCAGTGGG - Intronic
1181809097 22:25392619-25392641 TGCCTCTGGGTGCTAGGTGTTGG - Intronic
1181854737 22:25773881-25773903 TGCCTTTGGCTGCTGGGTGGAGG + Intronic
1182035526 22:27195436-27195458 TGCTTTTGGCTGCTTGGCGCAGG + Intergenic
1182301513 22:29339771-29339793 TGCCTGCTTCTGCTTGGAGATGG - Exonic
1183474212 22:38026925-38026947 TGCCTGGGGCAGCTGGGAGGGGG - Intronic
1183628900 22:39021431-39021453 TGCTTGCGGCTCCTTGCAGTTGG - Exonic
1184235167 22:43179418-43179440 TGCCTGTGGCTGCACGGTGGGGG - Intronic
950271868 3:11623114-11623136 TTCCTGTGGATGCTAGGATTTGG - Intronic
950712714 3:14824375-14824397 TGCCTAGGGGTGCTTGGGGTTGG + Intronic
950953160 3:17023001-17023023 GGCCAGTGGTTGCTTGGAGAGGG + Intronic
952232875 3:31449144-31449166 TGCTTTTGGGTGCATGGAGTAGG - Intergenic
952723726 3:36560287-36560309 TGGCTGTGGTTTCTTGGAGAAGG + Intergenic
952965978 3:38621473-38621495 TGCATGGGGCTGATGGGAGTCGG + Intronic
953164600 3:40453554-40453576 TGCCTGGGGCTGCCTGGGATGGG + Intergenic
953545895 3:43863385-43863407 GGCCTGTGGCTGCAGGGACTGGG + Intergenic
953708818 3:45252327-45252349 TGCCCCTGGCTTCCTGGAGTGGG + Intergenic
953924648 3:46976457-46976479 TGTCTGGGGCTGCTTGGCGTGGG - Intronic
954463436 3:50640660-50640682 TGCCTGTGGATCTATGGAGTTGG + Intronic
955357258 3:58241359-58241381 TGCCTGTGGCTGGATGGGTTTGG + Intronic
956646781 3:71464539-71464561 TTCCTCTGGCTCCTGGGAGTTGG + Intronic
961390623 3:126550504-126550526 TGCATGTAGCTGCTGGGAGATGG - Intronic
961801363 3:129452590-129452612 TGGGTGTGGCTGCTAGGAGCTGG + Intronic
963518100 3:146333966-146333988 TCTCTGTGCCTGCATGGAGTGGG + Intergenic
963881441 3:150533228-150533250 TGGCTGTGTCTACCTGGAGTAGG - Intergenic
964010154 3:151883392-151883414 TTCCTGTGACTTCTTGGAGTTGG - Exonic
965408626 3:168302070-168302092 TGCCTGATGTTGCTTGGATTCGG + Intergenic
965795958 3:172438853-172438875 TGCCTGTGGGTGTGTGGAGTGGG - Intergenic
966659843 3:182402129-182402151 TGCTGGTGGTTGCCTGGAGTTGG + Intergenic
967631132 3:191743675-191743697 TCTCTGTGCCTGCATGGAGTGGG - Intergenic
968956421 4:3722054-3722076 TGCATGTGGCAGCTTGGTATTGG - Intergenic
970134913 4:12912057-12912079 TGACTGTCTCTGCCTGGAGTTGG + Intergenic
970652266 4:18191985-18192007 TGTCTGTGGCTACTTGATGTTGG + Intergenic
975043181 4:69769728-69769750 TGCCTGTGGCAGGGTGGGGTAGG - Intronic
977476387 4:97515430-97515452 TGTTTGTGGGTGCTTAGAGTGGG + Intronic
978826218 4:113027071-113027093 TACCTGTGCATGCTTGAAGTTGG + Intronic
985673362 5:1217847-1217869 TGCCTGGGGCTGCCAGGGGTGGG - Intronic
986251251 5:6060388-6060410 GGCCGGTGGATGCTTGGAGGGGG - Intergenic
987304798 5:16627393-16627415 TGCTAGTGCCTTCTTGGAGTGGG - Intergenic
990622713 5:57578094-57578116 TGGCTTTGTCTGCTTGAAGTTGG - Intergenic
991519650 5:67481565-67481587 TGCCTGTGGCAGCTTGCTGCTGG - Intergenic
992495825 5:77292242-77292264 TGACTGTGGCTGGGTGGAGTTGG + Intronic
992750108 5:79853793-79853815 TGCCTGAGGCTGGCTGCAGTTGG + Intergenic
1001591882 5:172871179-172871201 GGCCTGAGGCTGATTGGAGATGG + Intronic
1003890299 6:10558008-10558030 AGCCTGTGGAGGCCTGGAGTAGG - Intronic
1007581405 6:42962395-42962417 TGCCTGGGGCTCCTTTAAGTGGG + Intronic
1007588506 6:43007329-43007351 TGGCCGTGGCTGCAGGGAGTGGG + Intronic
1007711916 6:43829930-43829952 TGCCTGTGGATGGGTGGGGTGGG + Intergenic
1007853993 6:44835220-44835242 TGCGTGGAGCTGTTTGGAGTTGG + Intronic
1007930470 6:45686394-45686416 TGCATGTGCCCCCTTGGAGTAGG + Intergenic
1007953773 6:45897482-45897504 TGCCTGTGGAAGATGGGAGTCGG + Intergenic
1008014321 6:46501296-46501318 TGCCTGTGACTCATTGGTGTGGG + Intergenic
1008245780 6:49171206-49171228 TGGCTGTGGCTTCTAGGATTAGG - Intergenic
1009392569 6:63162777-63162799 TGCCTTTTGCTGCTTACAGTAGG + Intergenic
1011699843 6:89945532-89945554 TGCCTGGGGCTGAGGGGAGTGGG + Intronic
1015618171 6:135101128-135101150 TACCTCTGGCTGATTGGGGTAGG + Intronic
1016396054 6:143624636-143624658 AGCCTGTGTCTGCTTGGATGGGG + Intronic
1016653394 6:146488854-146488876 AGCATGTGGCTGGATGGAGTAGG + Intergenic
1017030098 6:150213578-150213600 TCCCTGTGGCTGGAAGGAGTTGG + Intronic
1018037361 6:159892998-159893020 TGCCTACGGCTGCTTGGCCTGGG - Intergenic
1018390312 6:163336520-163336542 CTCCTGTGGCTGCTGGGGGTGGG - Intergenic
1018557740 6:165065823-165065845 TCTCTGTGCCTGCGTGGAGTGGG - Intergenic
1018988746 6:168657576-168657598 TGCTTTTGGCTTCTTGGACTGGG + Intronic
1019059701 6:169248211-169248233 TGCCTGTGGCTGCGTGTGGTGGG + Intronic
1019234619 6:170599961-170599983 TGCCATTGGCTGCATGGGGTGGG - Intergenic
1019567685 7:1692664-1692686 TGCCCCTGGCTGGGTGGAGTGGG + Intronic
1019801918 7:3094269-3094291 GCCCTGTGCCTGCCTGGAGTGGG - Intergenic
1021518054 7:21508192-21508214 TCTCTGTGCCTGCATGGAGTGGG - Intronic
1021985877 7:26098071-26098093 TGCCTGTGGCTGTTTGCACATGG + Intergenic
1023087700 7:36588411-36588433 TGGGTGAGGCTGATTGGAGTGGG - Intronic
1023263329 7:38379946-38379968 TTCCTGTGGTTGCTGGAAGTGGG - Intergenic
1024348374 7:48336589-48336611 GTCCTGTGGCTCCTGGGAGTGGG + Intronic
1024565889 7:50680580-50680602 GGCCTGTGGGTCCTGGGAGTCGG - Intronic
1026069039 7:67101302-67101324 TGTTTCTGGCTGCTTGTAGTTGG + Intronic
1026707861 7:72711021-72711043 TGTTTCTGGCTGCTTGTAGTTGG - Intronic
1026909843 7:74085134-74085156 TGCCTGTGGCTGGCTAGAGGAGG + Intronic
1028911486 7:96212696-96212718 TGTCTGTGGCTACCTGGAGCAGG - Intronic
1031313188 7:120225400-120225422 TAACTGTGGCTGCATAGAGTAGG - Intergenic
1032446575 7:131989370-131989392 TGCCAGGGGCTGCTGGGAGAGGG + Intergenic
1034002708 7:147433351-147433373 TGCCTGAAACTGATTGGAGTTGG + Intronic
1034498097 7:151433815-151433837 TGGCTGTGGCTACTGGGAGGAGG + Intronic
1034810948 7:154131409-154131431 TGACTGTGACTGCTTGAAGGAGG + Intronic
1035024343 7:155816253-155816275 GGCCTGTGGCAGCTTGGGGGTGG - Intergenic
1036017082 8:4796916-4796938 TGAGTGTGGCTGCATGGAGGGGG + Intronic
1036638015 8:10564767-10564789 TCCCTGTGGCTGCAGAGAGTTGG - Intergenic
1036662298 8:10716169-10716191 TTCCTGTGGCTGCTGGGACAGGG + Intergenic
1038047242 8:23775861-23775883 TGCCTGTGGCTGGGTAGAGTTGG + Intergenic
1038269382 8:26062802-26062824 TGCCTCTGGCTGCATGAGGTTGG - Intergenic
1039063752 8:33592246-33592268 TGCTTGTGGCAGCTTGGAGGAGG + Intronic
1039552086 8:38450638-38450660 TTCCTGTGACTACCTGGAGTCGG - Intronic
1040728454 8:50411944-50411966 TGCCTGTGTCTCCTTTGATTAGG + Intronic
1041700991 8:60788685-60788707 TGCCTGAGGCTGCTGGGTGCAGG + Intronic
1042103724 8:65301492-65301514 TGTCTGTGTGTGCATGGAGTGGG - Intergenic
1042180057 8:66078787-66078809 AGCCTCTGGTGGCTTGGAGTAGG - Intronic
1044378535 8:91504441-91504463 TGCCTGTGGCAGGGTGGAGAAGG + Intergenic
1047312059 8:123700282-123700304 TGCCTGTGGCTTGTAAGAGTGGG - Intronic
1048045485 8:130768701-130768723 GGCCTGTGGCTGGGTGGAGCTGG - Intergenic
1048578282 8:135709974-135709996 TGCCTGGGGCCACTTGGATTGGG - Intergenic
1051365982 9:16321772-16321794 TGCCTGTGAGTGCCTGGAATTGG - Intergenic
1051595452 9:18820244-18820266 TATCTGTGGCTCCTTGGATTAGG - Intronic
1054990382 9:71318937-71318959 AGCCTGTAGTTGCTTGGAGCTGG - Intronic
1056416704 9:86383780-86383802 TTCCTGTAGCTGCATAGAGTTGG + Intergenic
1056506096 9:87259646-87259668 TGCCTATGGCTGCTGGGAGGTGG - Intergenic
1056950602 9:91037845-91037867 TGCCTGCTGCTGCCTGGAGGAGG - Intergenic
1060018827 9:120110879-120110901 TGCAGGTCTCTGCTTGGAGTTGG + Intergenic
1060756833 9:126219788-126219810 TGGCTGTCGCTGCTTGGGGCTGG + Intergenic
1061855551 9:133440227-133440249 TGCCTGTGGCTCCTTAGAGGAGG + Intronic
1062214975 9:135384259-135384281 TGCCTGTGGCTTCCTGGACGGGG - Intergenic
1062300463 9:135864788-135864810 TGCCTCGGCCTGCATGGAGTGGG - Intronic
1062476302 9:136729028-136729050 TGCCTGTGGCTGCAGAGAGCAGG - Intergenic
1062668522 9:137692799-137692821 TGTCTGTTGCTGCTGGGTGTGGG + Intronic
1202630538 M:12981-13003 TGCCTGCTGCTGCTAGGAGGAGG - Intergenic
1187007791 X:15249305-15249327 TGAGTTTGGCTGCTTGGTGTAGG - Intronic
1187702217 X:21973632-21973654 TGCCTATGGCAGCTTAAAGTTGG - Intronic
1188674305 X:32919722-32919744 TGCCTGTGACTGCCTGTATTTGG - Intronic
1196724594 X:118885022-118885044 TCTCTGTGCCTGCGTGGAGTTGG + Intergenic
1197804303 X:130384639-130384661 TACCTGTGGCTGCTCGGCGTGGG - Exonic
1198719451 X:139600149-139600171 TGCCTAGGGCTGCTTAGATTGGG + Intronic
1200073559 X:153540533-153540555 TGCCTGTGGCTGCTGGCAACAGG - Intronic
1200984333 Y:9290023-9290045 TCCCTGTGGCTGGGTGGAGAAGG - Intergenic
1201315803 Y:12644187-12644209 TTGCTGTGGCTGCTGGGGGTAGG - Intergenic
1201759740 Y:17523643-17523665 TGCCTGTCCCTTCTTGGAGTCGG + Intergenic
1201841814 Y:18382347-18382369 TGCCTGTCCCTTCTTGGAGTCGG - Intergenic
1202126110 Y:21570221-21570243 TCCCTGTGGCTGGGTGGAGAAGG + Intergenic
1202152894 Y:21859176-21859198 TCCCTGTGGCTGGGTGGAGAAGG - Intergenic