ID: 1077523521

View in Genome Browser
Species Human (GRCh38)
Location 11:3050325-3050347
Sequence GTGCCTGTGGCTGCTTGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 311}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077523521_1077523525 -4 Left 1077523521 11:3050325-3050347 CCACTCCAAGCAGCCACAGGCAC 0: 1
1: 0
2: 3
3: 40
4: 311
Right 1077523525 11:3050344-3050366 GCACCCAGAAGCAAAGCTCTGGG 0: 1
1: 0
2: 3
3: 23
4: 220
1077523521_1077523524 -5 Left 1077523521 11:3050325-3050347 CCACTCCAAGCAGCCACAGGCAC 0: 1
1: 0
2: 3
3: 40
4: 311
Right 1077523524 11:3050343-3050365 GGCACCCAGAAGCAAAGCTCTGG 0: 1
1: 0
2: 3
3: 34
4: 532
1077523521_1077523528 18 Left 1077523521 11:3050325-3050347 CCACTCCAAGCAGCCACAGGCAC 0: 1
1: 0
2: 3
3: 40
4: 311
Right 1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG 0: 1
1: 0
2: 1
3: 3
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077523521 Original CRISPR GTGCCTGTGGCTGCTTGGAG TGG (reversed) Intronic
900379649 1:2377534-2377556 CTGCCCCAGGCTGCTTGGAGTGG - Intronic
900529710 1:3146986-3147008 GTGCATGTGTGTGCTTGGTGTGG + Intronic
900630500 1:3632590-3632612 GTGCCAGGGGCTGACTGGAGAGG + Intronic
900799434 1:4728251-4728273 TGGCCTTTGGCAGCTTGGAGAGG + Intronic
901535861 1:9882734-9882756 GTGGCTGTGGCTGTGGGGAGAGG + Intronic
901974385 1:12932651-12932673 GTGCTTGTGGCAGCCTGGGGTGG - Intronic
902010787 1:13269117-13269139 GTGCTTGTGGCAGCCTGGGGTGG + Intergenic
902375475 1:16028253-16028275 GTGACTGTGGGGACTTGGAGAGG - Intronic
904569022 1:31446893-31446915 ATGCCAGTGGCTGCTCAGAGAGG + Intergenic
904674676 1:32191641-32191663 GTGCCTGTGTCTGTCTGGGGAGG - Intronic
904753907 1:32757571-32757593 GTGCTTGAGGCTGCTTGGCTGGG + Intronic
906130066 1:43450662-43450684 GTGGCTGTGGGTGTTTGGGGAGG - Exonic
906476371 1:46172032-46172054 CTGCCTGAGGCTGGCTGGAGCGG + Intronic
906787728 1:48630515-48630537 GTGACTGTGGCTGATGGGAGAGG - Intronic
906970310 1:50506495-50506517 GTACCTGTGATTGCTTAGAGCGG - Intronic
907716654 1:56932653-56932675 ATGTCTCTGGCTCCTTGGAGAGG - Intronic
909404950 1:75277836-75277858 GTGCCAGAGGCTGTGTGGAGAGG - Intronic
911221680 1:95253821-95253843 GTGGCTGTGGTTGCTTCCAGTGG + Intergenic
911842677 1:102704097-102704119 GTGCCTTAGGCTGGTTGCAGTGG - Intergenic
912382444 1:109254758-109254780 GTTCCTGTGGCTACTTTGAAGGG - Intronic
912993309 1:114510450-114510472 GGGCCTGGGGCTGCTCGGACGGG - Intronic
913459538 1:119069760-119069782 GTGACTGTGGCTGCCTTGTGGGG + Intronic
913531894 1:119739392-119739414 TTGTCTGTGACTCCTTGGAGAGG + Intronic
919273786 1:195385479-195385501 GTCCCTGTGGCTGCTTTCATGGG - Intergenic
920191505 1:204196816-204196838 GTGTCTGTGGCTCTTCGGAGAGG - Intergenic
920265769 1:204721497-204721519 GGGGCTCTGGCTCCTTGGAGTGG + Intergenic
920284139 1:204867790-204867812 GTCTCTGTCTCTGCTTGGAGTGG - Intronic
920382135 1:205541324-205541346 GTGCCTGCTGCTGCATGGAAGGG - Intergenic
924568573 1:245218238-245218260 GTGCCTGTGGCTTCTCAGTGGGG + Intronic
1062792451 10:317347-317369 TTGCCTGTTTCTGCTTTGAGTGG + Intronic
1063565614 10:7170619-7170641 GTGCCTGTTGCTGCCAGGTGAGG - Intronic
1063691436 10:8290986-8291008 GTGTTTCTGGCTGCATGGAGTGG + Intergenic
1065354291 10:24824293-24824315 TTGCCAGGGGCTGGTTGGAGGGG - Intergenic
1065888678 10:30101683-30101705 ATGCCTGTGGCTGAGAGGAGGGG + Intronic
1066279932 10:33906559-33906581 GTGCCTGTTGGTGCTTGGGTTGG + Intergenic
1067069795 10:43123410-43123432 GTGCGTGTGGCTGCTCTGATGGG + Intronic
1069641919 10:69961843-69961865 GTGCCTGTGGCTGCGTGCTCTGG + Intronic
1070720724 10:78755172-78755194 GTGCCTGCCCCTGCTTGGGGTGG + Intergenic
1072559262 10:96555271-96555293 GTGCTTGTGGATTCTTGAAGAGG - Intronic
1074155296 10:110793296-110793318 GGGACAGTGGCTGCTTGGGGTGG - Intronic
1074611811 10:115028906-115028928 GTGCCTGTGGCCCACTGGAGAGG + Intergenic
1075174073 10:120143240-120143262 GCTCCTGTGGGTGCTTGCAGTGG + Intergenic
1075264631 10:120990080-120990102 GTGCTTGTGGCTGTTGGGATGGG - Intergenic
1075658329 10:124175988-124176010 CTGCCTGTGGCTGCGTGCACAGG - Intergenic
1076383034 10:130038155-130038177 GTGCCTGTACCTGCTGGAAGAGG - Intergenic
1076524477 10:131102855-131102877 GGGCCTGTTGTTGCTGGGAGAGG - Intronic
1076541299 10:131216840-131216862 GCCCCTGTGGCAGCTGGGAGAGG + Intronic
1076805928 10:132858720-132858742 GTGCCTGTGGCTGGTGGGGGTGG + Intronic
1076841908 10:133049988-133050010 GTGCCTGTTGGCGCTGGGAGAGG + Intergenic
1077523521 11:3050325-3050347 GTGCCTGTGGCTGCTTGGAGTGG - Intronic
1077740305 11:4838975-4838997 ATGTCTCTGGGTGCTTGGAGAGG + Intronic
1078725499 11:13926810-13926832 GTGCCTGTGGCGGGGTGGGGGGG - Intergenic
1080559053 11:33445234-33445256 GTGGGGGTGGCTGCTGGGAGAGG + Intergenic
1080776618 11:35392779-35392801 GTGCATGTGTATGCTTGGAGAGG + Intronic
1081358566 11:42144402-42144424 GTCCCTGTGGCTGCTTTCACAGG + Intergenic
1081687533 11:45053373-45053395 GTGGCTGTGGCAGCTGGGAGTGG - Intergenic
1082118974 11:48357614-48357636 GTCCCTGTGGCTGCTTTCATGGG + Intergenic
1082255325 11:50027535-50027557 GTCCCTGTGGCTGCTTTCATAGG - Intergenic
1084465239 11:69319505-69319527 GGGCCTCTGGCTGCTGGGTGGGG - Intronic
1088450609 11:109977675-109977697 TTGGCTGGGGCTGGTTGGAGAGG + Intergenic
1088896633 11:114083509-114083531 GTGGCTGAGGAAGCTTGGAGGGG - Intronic
1089295929 11:117468114-117468136 CTGACTGTGGCTGTTTGGAGAGG - Intronic
1089413598 11:118267666-118267688 GAGCCTGAGGCTTATTGGAGAGG - Intergenic
1089687612 11:120166736-120166758 CTGCTGGTGGCTGCTTGGGGAGG + Intronic
1090868089 11:130719738-130719760 GTGCCTTTGTGTGCTTGGAGGGG + Intergenic
1091242966 11:134066718-134066740 GTGCCTTTGGCTGAGAGGAGGGG + Intergenic
1091323610 11:134668263-134668285 CTTCCTGTGGCTGCGTGGAGGGG + Intergenic
1091664592 12:2410157-2410179 GTCCCTCTGGCAGATTGGAGTGG - Intronic
1092912441 12:13159095-13159117 ATGTCTGTGACTGCTGGGAGGGG + Intergenic
1093005200 12:14043775-14043797 GTCCCTGTAGCTCCATGGAGGGG - Intergenic
1094352456 12:29542189-29542211 GTGTCTGTGCCTGATTGGACAGG - Intronic
1096277297 12:50220389-50220411 CTCCCTAAGGCTGCTTGGAGAGG - Intronic
1096626015 12:52896493-52896515 GTGGCTGTGACTGAGTGGAGTGG + Intergenic
1097191891 12:57223415-57223437 GTGTGTGTGGCTGCTTGTCGTGG - Intronic
1097284026 12:57864047-57864069 GTGCCAGTGTCTGTTTGAAGAGG + Intergenic
1099897289 12:88664549-88664571 GTTCCTGGGGCTGCTTTGAAGGG + Intergenic
1101584284 12:106070995-106071017 GTTCCTGGGGCTGCTGGGGGTGG - Intronic
1101982979 12:109423595-109423617 TTTCCAGTGGCTGCTGGGAGGGG - Intronic
1102481552 12:113227237-113227259 CTGCCTGTGGATGCTTGGTGGGG + Intronic
1103120679 12:118376928-118376950 GGGCCTGGGGCTGCGTGGAGGGG + Intronic
1103579302 12:121902571-121902593 GTGCCTGTGGCTGCTTGTCTGGG + Intronic
1104328919 12:127826087-127826109 GTGCCTGGGGCAGTTCGGAGAGG - Intergenic
1104685359 12:130781134-130781156 GAGCCTGTGGCTGCTCGGTGTGG + Intergenic
1104726053 12:131076460-131076482 GAGCCTGTGGCTACCTGGTGGGG + Intronic
1104726065 12:131076493-131076515 GAGCCTGTGGCTGCCTGGTGGGG + Intronic
1105007907 12:132734346-132734368 GTGGCTGTGGCAGCTGGGAGGGG - Intronic
1105423117 13:20270640-20270662 GTGCCGGGGGCTGCTGTGAGGGG - Intergenic
1107330758 13:39296873-39296895 GTTCCTGTGGCTGCTTTCACGGG - Intergenic
1107594460 13:41948070-41948092 TTGCATATGGATGCTTGGAGTGG + Intronic
1107936192 13:45347080-45347102 GTGCCTATGGCTGGGTGCAGTGG + Intergenic
1109653054 13:65353732-65353754 GTGCCTGTGGCTGTAGGGATTGG - Intergenic
1112321256 13:98409763-98409785 GTGCCAGTGGCTGGCAGGAGGGG - Intronic
1113364715 13:109665433-109665455 GTGCGTGTGGATGCTGGCAGCGG + Intergenic
1122276466 14:100593239-100593261 GTGCCTGTGGGTGGTCGGGGTGG - Intergenic
1123948826 15:25251763-25251785 TTTCCAGTGCCTGCTTGGAGTGG + Intergenic
1124552312 15:30693077-30693099 GTGCCTGTGGGAGCTGGCAGGGG + Intronic
1124678927 15:31712589-31712611 GTGCCTGTGGGAGCTGGCAGGGG - Intronic
1125755767 15:42063659-42063681 ATGCATGTGGCTGCTGGCAGGGG - Intergenic
1126672830 15:51132032-51132054 ATGCCTGTGGATGCTAGGGGTGG + Intergenic
1127036506 15:54923954-54923976 GTGCCTGTGGAAGCTGGGGGAGG - Intergenic
1127945377 15:63745578-63745600 GTGTCTCTGGGTGCTTGGGGAGG - Intronic
1128002534 15:64206668-64206690 GTGCCTTTGGCTGTTTGGCTAGG - Intronic
1128149715 15:65355451-65355473 GAGCCTGGGGCCGCTTGGACCGG - Intronic
1129969302 15:79763410-79763432 GAGCCTGTGGCTGTGTGGGGAGG - Intergenic
1130149939 15:81303802-81303824 GAGCCTGGGGCTGCGTGGAGAGG + Intronic
1130423626 15:83773693-83773715 GTGCCTCTGGATGGGTGGAGAGG + Intronic
1130624395 15:85498785-85498807 ATGCCTGTGGCTGCTGGTTGCGG - Intronic
1130971698 15:88738867-88738889 GAGCCAGGGGCCGCTTGGAGGGG + Intergenic
1131168689 15:90161294-90161316 GTGCCTGTGGATGCTTTGTCTGG + Intronic
1131372106 15:91891208-91891230 GTACCTGTGGCTGATTTGAATGG - Intronic
1132345880 15:101108546-101108568 ATGCCTGTAGCTGCTGGAAGGGG + Intergenic
1132868627 16:2105698-2105720 GTGGGTGTGGCTGCTGGGAGCGG + Intronic
1134288329 16:12881979-12882001 TTGCCTGTGGCTGGGTGCAGTGG + Intergenic
1134522960 16:14926961-14926983 GTGGGTGTGGCTGCTGGGAGCGG - Intronic
1134549666 16:15133097-15133119 GTGGGTGTGGCTGCTGGGAGCGG + Intronic
1134710628 16:16325612-16325634 GTGGGTGTGGCTGCTGGGAGCGG - Intergenic
1134718798 16:16369900-16369922 GTGGGTGTGGCTGCTGGGAGCGG - Intergenic
1134948974 16:18343033-18343055 GTGGGTGTGGCTGCTGGGAGCGG + Intergenic
1134955958 16:18382259-18382281 GTGGGTGTGGCTGCTGGGAGCGG + Intergenic
1135058102 16:19247517-19247539 GTGCCACTGGCTGGTTGCAGTGG - Intronic
1135935387 16:26775440-26775462 GTTCCTGTGGCAGCTTGTTGAGG + Intergenic
1137576606 16:49604204-49604226 GTGGCCGTGGGTGCTTTGAGAGG - Intronic
1138266719 16:55664936-55664958 GTGCCTGAGGCTGTTTGGGCAGG - Intronic
1140200368 16:72890001-72890023 ATGCCAGTGGCCGCTTCGAGTGG - Intronic
1140737011 16:77907464-77907486 GTGCCTAGGGCTGCTGAGAGAGG - Intronic
1141423104 16:83929991-83930013 CTGTCAGTGGCTGCTTGCAGTGG + Intronic
1141714998 16:85721788-85721810 GTGCCTGGGGCTACACGGAGGGG + Intronic
1142277917 16:89132657-89132679 GGGGCTGGGGCAGCTTGGAGCGG - Intronic
1143156832 17:4842759-4842781 GTGCATGTGGCGTCTTAGAGAGG + Intronic
1143599432 17:7934445-7934467 GTCCCTCTGGCTGCCTGCAGGGG + Exonic
1146615033 17:34349815-34349837 TTGGCAGTGGCTGCATGGAGCGG + Intergenic
1147595635 17:41715511-41715533 GTGCATCTGGCTGCTGGGAGCGG - Exonic
1147958067 17:44148641-44148663 GTCCCTCTAGCAGCTTGGAGAGG - Exonic
1149238974 17:54626272-54626294 GTGGCTGTGGCTCATTGGACAGG + Intergenic
1149449817 17:56740802-56740824 GTGCTTTTGTCTTCTTGGAGAGG - Intergenic
1149457788 17:56802301-56802323 GTGGCTGTGACTCCTTGGTGAGG - Intronic
1149492374 17:57094406-57094428 GTGCCTGTCCCTGCATGGATCGG - Intronic
1149557749 17:57586255-57586277 GTGCCTGCGGCTGCAGGGAAAGG - Intronic
1149866707 17:60155065-60155087 GGGCCAGTGGCTGCTTGGCCTGG + Intronic
1150458846 17:65330412-65330434 GTGCCTGTGGGAGCCTGGCGAGG - Intergenic
1151604981 17:75130376-75130398 GTGCCTCTGGCCCCGTGGAGTGG - Exonic
1151665431 17:75542825-75542847 ATGGCTGTGGCTGGTTGGAGAGG + Intronic
1152038210 17:77886466-77886488 GCACCTGCGGCTGCTTCGAGGGG - Intergenic
1152206723 17:78978165-78978187 GACCTTGAGGCTGCTTGGAGGGG + Intronic
1152222701 17:79077795-79077817 GGGCCTCTGGCTGCTCAGAGGGG - Exonic
1152888672 17:82867398-82867420 GTGCCTGGGGCTGCCTGGAGTGG + Intronic
1153955664 18:10093509-10093531 GTGCCTGTGTCTGCTCTGAGAGG - Intergenic
1154042019 18:10865402-10865424 GAGGCAGTGGCTGCTTGGTGAGG + Intronic
1154502523 18:15003834-15003856 GTGCCTGTCACTGCCTGGGGAGG + Intergenic
1155601463 18:27553539-27553561 GTACCTGTGGCTGGGTGCAGTGG - Intergenic
1159704932 18:71674948-71674970 GGGTCTGTGGGTGCTTGGGGTGG - Intergenic
1160565200 18:79782785-79782807 GGGCCTGGGGCTGCTTGCTGGGG - Intergenic
1160847456 19:1172886-1172908 CTGCCTGTGACTGCTGGGACGGG - Intronic
1160943232 19:1629718-1629740 GTGACTGGGGCTGCTGTGAGGGG + Intronic
1161162872 19:2770356-2770378 GTGCCTGGGCCAACTTGGAGGGG + Intronic
1161440123 19:4286464-4286486 GTGCCTGTGGTCCCATGGAGAGG - Intronic
1161794878 19:6380862-6380884 GTGGCTGTGGCTGTGGGGAGCGG + Intronic
1162813495 19:13179226-13179248 GTGCCAGGGGCTGCTGGGAGGGG - Intergenic
1162937707 19:13989784-13989806 CTCCCTCTGGCTGCTGGGAGGGG + Intronic
1163492157 19:17623385-17623407 GTGCCTGTGTCTGTCTGGGGCGG - Intronic
1163990877 19:20998272-20998294 GTCCCAGTTGCTGTTTGGAGGGG - Intergenic
1166126767 19:40719257-40719279 GTGCCTGTGCCTGTGTGCAGGGG + Intronic
1166564696 19:43756566-43756588 CTACCTGTGGCAGCCTGGAGAGG - Intergenic
1167038096 19:47006051-47006073 TTGGCAGTGGCTGCCTGGAGAGG - Intergenic
1167323802 19:48812254-48812276 GGGCCTGTGGCTGTTAGGGGTGG - Intergenic
1167513538 19:49909647-49909669 GTACTTGTGGCTGGTTGGAAGGG + Exonic
1168617571 19:57850771-57850793 GTTCTTATGGCTGATTGGAGGGG + Intronic
925429538 2:3779222-3779244 GTGCAGGTGGCTGTGTGGAGTGG + Intronic
926796895 2:16626778-16626800 CCGCCTGTGGCTGCTTGGATGGG - Intronic
927157957 2:20232495-20232517 GTGCCTGTGGAGGCTGGGTGGGG - Intergenic
927714983 2:25345975-25345997 GTGCCAGGGGCTGCGGGGAGGGG + Intergenic
928082259 2:28321816-28321838 TTGCCTCTCACTGCTTGGAGAGG + Intronic
928720044 2:34109941-34109963 GTGCCTGTAGATGCTGGGGGCGG - Intergenic
928919553 2:36512419-36512441 GTGCCCCTGGCTGCTTTGAGGGG - Intronic
929537333 2:42792024-42792046 TTGCCTGTGGCTTCTGGGACAGG + Intronic
931447152 2:62336278-62336300 GTTCCTCTGGCTGCTGTGAGGGG - Intergenic
932827851 2:74958389-74958411 GTGCCTGTGCCTGGCTGGTGAGG - Intergenic
934769467 2:96898741-96898763 GGGCCTTGGGCTGCTAGGAGGGG + Intronic
935181011 2:100691321-100691343 GTGCCTGGTTCTGCCTGGAGGGG + Intergenic
935329253 2:101964493-101964515 GTGCAGGTGGGTGCTGGGAGCGG + Intergenic
935716801 2:105946448-105946470 TTGCCTGTGGCAGCCTGGACTGG - Intergenic
936236745 2:110748658-110748680 GTGCAGGTGGCTCCTGGGAGTGG + Intronic
937005436 2:118508305-118508327 GTGTCTCTGGCTCCATGGAGGGG - Intergenic
938065595 2:128280424-128280446 ATGCCTGTGCCTCCTGGGAGCGG - Intronic
938290089 2:130144465-130144487 GTGTCTGACCCTGCTTGGAGAGG + Intronic
938466440 2:131528480-131528502 GTGTCTGACCCTGCTTGGAGAGG - Intronic
938501698 2:131834005-131834027 GTGCCTGTCACTGCCTGGGGAGG + Intergenic
938983928 2:136554541-136554563 GTGGCTGTGCCTGGGTGGAGTGG - Intergenic
939057339 2:137381241-137381263 GTGCCTTTCCCTGCTTGCAGGGG - Intronic
940176422 2:150882188-150882210 GGGCCTGTGGCTGGTTGGGAGGG - Intergenic
944321308 2:198346754-198346776 GTGTGTGTGTCTGGTTGGAGTGG + Intronic
946188466 2:217994804-217994826 TCCCCTGTGGCTGCTTAGAGAGG - Intronic
946360762 2:219218292-219218314 TGGCCTGTGGCTGCTTGTCGTGG - Exonic
947245566 2:228044128-228044150 ATACCTGAGGCTTCTTGGAGAGG - Intronic
947300264 2:228681691-228681713 GTGTTTGTGGCTGCTTCGTGAGG - Intergenic
948478545 2:238236673-238236695 GAGCCTGGGGGTGCTGGGAGAGG + Intergenic
1169013785 20:2274472-2274494 GTGCCTGTGGCAGCTGGGATGGG + Intergenic
1171011481 20:21511742-21511764 TTGCCTGCGTCTCCTTGGAGTGG - Exonic
1171275860 20:23855994-23856016 GTGCCTGAGGCTGGGAGGAGGGG + Intergenic
1172132428 20:32664602-32664624 CTGCCTGTGGCTGCATCTAGAGG - Intergenic
1173658138 20:44715032-44715054 GAGCCTGTGACAGCTTGCAGAGG - Exonic
1174527106 20:51181494-51181516 GGGGCAGTGGCTGTTTGGAGGGG + Intergenic
1175117062 20:56690062-56690084 ATTCCTGTGGCTGCTGGGAGCGG - Intergenic
1175568935 20:60004134-60004156 GTCCCTAGGGCTGCTTGTAGTGG + Intronic
1175799288 20:61792024-61792046 ATGCCTTTGGCTGCCTGGTGGGG + Intronic
1176139105 20:63537421-63537443 GCGCCTGTGGGTGCTGGGTGTGG - Intergenic
1176667158 21:9698211-9698233 CTGCCTGCGGCATCTTGGAGAGG - Intergenic
1179494140 21:41761051-41761073 AAGCCTGTGGCTGCAGGGAGAGG - Intronic
1179829847 21:43989646-43989668 CTGCCTGTGCCAGCATGGAGGGG + Intergenic
1179903583 21:44407610-44407632 GTGGCTGTGGCTGAGGGGAGGGG - Intronic
1180080590 21:45485979-45486001 GAGCTTGTGGCTGCGAGGAGAGG + Intronic
1180349262 22:11785804-11785826 GTCCCTGTGGCTGTTAGGTGGGG - Intergenic
1180373551 22:12069257-12069279 GTCCCTGTGGCTGTTAGGTGGGG - Intergenic
1180505197 22:15989585-15989607 CTGCCTGTGGCTATTTGGATTGG + Intergenic
1180618778 22:17146234-17146256 TTGCCTGTGGCTTCTTGGAGGGG - Intronic
1181082116 22:20422956-20422978 GTTCCAGTGGCTGCTGGGAAGGG - Intergenic
1181266878 22:21635635-21635657 GTGACAGTGGCTGCTAGGAGTGG - Intronic
1181431206 22:22882850-22882872 ATGCCTGTCGCTGCTTCCAGTGG - Intronic
1183474213 22:38026926-38026948 TTGCCTGGGGCAGCTGGGAGGGG - Intronic
1184235168 22:43179419-43179441 CTGCCTGTGGCTGCACGGTGGGG - Intronic
1184430726 22:44440354-44440376 GGTCCTGTGTCTGCTGGGAGTGG - Intergenic
1185266560 22:49907082-49907104 GTGCCTATGGCTGGGTGCAGAGG - Intronic
950124955 3:10505316-10505338 GTGGCGGTGGCAGCGTGGAGGGG - Intronic
950285687 3:11743020-11743042 GTGGCTGTGTCTGGTTGGGGGGG - Intergenic
950953159 3:17023000-17023022 TGGCCAGTGGTTGCTTGGAGAGG + Intronic
952199090 3:31106880-31106902 GTGCCTGATTCTGCCTGGAGAGG + Intergenic
952341829 3:32453661-32453683 CGGCCTGGGGCTGCTGGGAGAGG + Intronic
953545894 3:43863384-43863406 GGGCCTGTGGCTGCAGGGACTGG + Intergenic
953708817 3:45252326-45252348 GTGCCCCTGGCTTCCTGGAGTGG + Intergenic
953924649 3:46976458-46976480 ATGTCTGGGGCTGCTTGGCGTGG - Intronic
954216199 3:49125810-49125832 GTGCCTGTGCAAGCCTGGAGTGG - Exonic
955343281 3:58142222-58142244 GTGCAAGTGGCGGCTTTGAGAGG - Intronic
957868060 3:86050349-86050371 GTGCCTGTGGCTGCTCTTATGGG + Intronic
958040307 3:88219515-88219537 GTGGTTGTGGGTACTTGGAGTGG + Intergenic
958256602 3:91332366-91332388 GTCCCTGAGGCTGCTTTCAGGGG - Intergenic
959758353 3:109926454-109926476 GCGCCTGTGGCTATGTGGAGGGG + Intergenic
961661316 3:128470119-128470141 GTGCATGTGGCTGGGTGGGGGGG - Intergenic
965795959 3:172438854-172438876 ATGCCTGTGGGTGTGTGGAGTGG - Intergenic
967963911 3:194945677-194945699 GAGCCTGAGGCTGTTGGGAGGGG + Intergenic
968523105 4:1043217-1043239 GTGCCTGTGGGTGCATGTAAGGG - Intergenic
969153812 4:5192871-5192893 GTGCCAGGGGCTGGGTGGAGGGG - Intronic
969470903 4:7388805-7388827 GTGCCCGGGGCTGCCTTGAGTGG + Intronic
977476386 4:97515429-97515451 GTGTTTGTGGGTGCTTAGAGTGG + Intronic
977574622 4:98663064-98663086 GAGCATGTGGCTGCTTTAAGAGG - Intergenic
979185998 4:117793935-117793957 GTTCATCTGGCTGATTGGAGAGG + Intergenic
980247608 4:130267481-130267503 GTTCCTGTGGCTGCTTTCACAGG - Intergenic
980619343 4:135278300-135278322 GTGACTGAGGATGCTTGTAGGGG - Intergenic
981669913 4:147275126-147275148 GAGCCTGGGGCTGCTGGGTGGGG + Intergenic
983804420 4:171976208-171976230 CTGCCTGTGGCTGGGTGCAGTGG - Intronic
985041892 4:185899161-185899183 TTGCCTGTGAATGCTGGGAGGGG - Intronic
985407851 4:189654126-189654148 CTGCCTGCGGCATCTTGGAGAGG + Intergenic
985673363 5:1217848-1217870 GTGCCTGGGGCTGCCAGGGGTGG - Intronic
986099773 5:4596384-4596406 GTCCCTGTGGCTGCTTTCACAGG - Intergenic
986251252 5:6060389-6060411 GGGCCGGTGGATGCTTGGAGGGG - Intergenic
986691931 5:10320416-10320438 CTGCCTGTGGCTGAGTGCAGTGG + Intergenic
986693691 5:10333775-10333797 CTGCCCGGGGCTGCTGGGAGGGG + Intergenic
986992662 5:13571985-13572007 GTGTGTGTGGCTGCTGGGAAGGG + Intergenic
987457257 5:18162971-18162993 TTGACTGTGGGTGCATGGAGTGG + Intergenic
988604646 5:32668838-32668860 GCACCTGTGGCTGTTTGGATGGG + Intergenic
988871062 5:35390529-35390551 GAACATGTGGATGCTTGGAGGGG + Intergenic
990009224 5:50975842-50975864 GTGCCTGTTGATGCTTGGGTTGG - Intergenic
992027463 5:72684696-72684718 TTCCCAGTGGCTGCTTGGAGAGG - Intergenic
992622890 5:78610955-78610977 GTGCCTGTGGCTCCTTGAGGAGG - Intronic
992625393 5:78632121-78632143 GTCCCTGTGGCTGTTGTGAGTGG - Intronic
993320711 5:86465484-86465506 GTGCCTGGGGCTGCATGCATTGG - Intergenic
993876733 5:93316296-93316318 TTGCCAGTGGCTGCAGGGAGAGG - Intergenic
994117069 5:96072754-96072776 GTGGCTCTTGCTGTTTGGAGTGG + Intergenic
994720067 5:103370029-103370051 GTGGCTGTAGCAGCCTGGAGTGG + Intergenic
996071538 5:119137057-119137079 GTGCCTGTGGCTGCTTTCACAGG - Intronic
997709420 5:135991113-135991135 GTGCGTTTGGCTGCTGAGAGAGG - Intergenic
997716132 5:136044382-136044404 GAGCCTGTGCCTGCTGGGAAGGG - Intronic
999153196 5:149440480-149440502 GTGCCTGAGGCTGCAGGGATGGG - Intergenic
999276012 5:150330659-150330681 TTTCATGTGGCTGCTGGGAGGGG - Intronic
1001100626 5:168810887-168810909 GTCCCTGCGGCTGCTTGCATGGG + Intronic
1001207662 5:169779412-169779434 GTGCCTGTGGTTGGGGGGAGGGG + Intronic
1001516400 5:172358320-172358342 GTGTCTGTGGGTGAGTGGAGGGG + Intronic
1002138368 5:177122614-177122636 GTGCCTCTGTTTTCTTGGAGAGG - Intergenic
1002931649 6:1639112-1639134 GTGCCTGTGGATACGGGGAGAGG + Intronic
1006167272 6:32072274-32072296 GTGGCTGGGGCTGGTGGGAGGGG + Intronic
1006336753 6:33425103-33425125 GTTCCTGTGGCTCTTTGTAGAGG + Intronic
1008014320 6:46501295-46501317 GTGCCTGTGACTCATTGGTGTGG + Intergenic
1008998739 6:57688794-57688816 GTCCCTGAGGCTGCTTTCAGGGG + Intergenic
1009187223 6:60588173-60588195 GTCCCTGAGGCTGCTTTCAGGGG + Intergenic
1012858233 6:104528207-104528229 GGGACTGTGCCTGCTTGGATTGG - Intergenic
1013408937 6:109867154-109867176 GTGCCTGTGGCTACTTGTTGTGG + Intergenic
1013533940 6:111046562-111046584 GTGGTTGTGTCTGCTTTGAGGGG - Intergenic
1015345106 6:132147208-132147230 GTGCTTATTGCTGCTTGGAGTGG + Intergenic
1016396053 6:143624635-143624657 CAGCCTGTGTCTGCTTGGATGGG + Intronic
1017630377 6:156391168-156391190 GTGCCTGGGCCTGCTTGCACAGG - Intergenic
1018037362 6:159892999-159893021 GTGCCTACGGCTGCTTGGCCTGG - Intergenic
1018745388 6:166757731-166757753 GAATCTGTGGCTGCCTGGAGAGG - Intronic
1019059700 6:169248210-169248232 ATGCCTGTGGCTGCGTGTGGTGG + Intronic
1019380091 7:716871-716893 GTGATTGTGGCTGATGGGAGAGG + Intronic
1019696072 7:2446808-2446830 GTCCCTGTGGGAGATTGGAGCGG + Intergenic
1019801919 7:3094270-3094292 GGCCCTGTGCCTGCCTGGAGTGG - Intergenic
1023779353 7:43641870-43641892 GTGCCTGTGTCTCCTTCGCGAGG - Intronic
1024109971 7:46134751-46134773 GTGACTGGGGCTTCTTGGAGAGG - Intergenic
1024716268 7:52082623-52082645 ATGCCTGTGATTGCTTGTAGTGG + Intergenic
1029471655 7:100758521-100758543 GTGGCAGTGCCTGCTGGGAGGGG - Exonic
1029926782 7:104327785-104327807 GGGCCTGTGTGTGCTTGGAAGGG - Intergenic
1031288408 7:119901189-119901211 TTGCCTGGGGCTGGGTGGAGGGG + Intergenic
1031932279 7:127697796-127697818 GTACCTGTTACTGCTTGCAGAGG + Intronic
1032446574 7:131989369-131989391 TTGCCAGGGGCTGCTGGGAGAGG + Intergenic
1034493707 7:151408048-151408070 GTGTGTGTGGCTGTTTGGGGGGG + Intronic
1034992580 7:155557562-155557584 GTGCCTGAGTCTGCTGGGAAAGG - Intergenic
1035331102 7:158098070-158098092 GTGCCCGTGGCTGCTGGGCCCGG + Intronic
1035587468 8:786841-786863 GTGAACGTGGCTTCTTGGAGGGG + Intergenic
1035708628 8:1695928-1695950 GTGCCTGGGGGGGCTTTGAGTGG + Intronic
1036017081 8:4796915-4796937 CTGAGTGTGGCTGCATGGAGGGG + Intronic
1036139872 8:6197623-6197645 GTGTCTGTCGCTGCTGGGACAGG + Intergenic
1036435446 8:8729037-8729059 GTGCCCGTGGCTGCGGGCAGTGG + Intergenic
1036662297 8:10716168-10716190 CTTCCTGTGGCTGCTGGGACAGG + Intergenic
1039886064 8:41654397-41654419 GCCCCTGTGGCCTCTTGGAGAGG - Intronic
1039910096 8:41819667-41819689 GTGACTGTGCCTGCTTTCAGGGG - Intronic
1041684636 8:60632067-60632089 TTGCCTGGGGCTGGGTGGAGGGG - Intergenic
1042499458 8:69492513-69492535 CTGCCTGTGGCAGGATGGAGTGG - Intronic
1042533257 8:69835040-69835062 GCGCGTGTGTCTGTTTGGAGCGG - Exonic
1045258113 8:100546761-100546783 GTCCCTGTGGCTGCTTTCATGGG - Intronic
1047501346 8:125444206-125444228 CTGCCTGTGCCTACTAGGAGTGG + Intergenic
1048254543 8:132895896-132895918 GAGCATGTGGCTACTTGGAGAGG - Intronic
1048995922 8:139793693-139793715 GAGGCTGTGGCTGTTTAGAGAGG + Intronic
1049580562 8:143408753-143408775 GGACCTGTGGCTGCTTGGAGAGG + Intergenic
1049599958 8:143503152-143503174 GGCCATGTGGCTGCTTGGGGCGG - Intronic
1049605449 8:143527098-143527120 GTGCCCCTGGCTGCCTGGTGGGG + Intronic
1049632090 8:143664407-143664429 ATGCCTGTGGCTCCATGGGGAGG - Intergenic
1057078734 9:92155918-92155940 GGGCCTGTTGTTGCTGGGAGAGG - Intergenic
1057310959 9:93942978-93943000 AAGCCAGTGGCTGCTTGAAGGGG + Intergenic
1059302348 9:113324210-113324232 GTGCCAGCGGCTGCGGGGAGAGG - Intronic
1059458894 9:114417190-114417212 TTGACTGTGTCTGCTTTGAGGGG + Intronic
1061922054 9:133787810-133787832 GGGCCTGTGGCTGCTGGGGCGGG - Intronic
1061922071 9:133787851-133787873 GGGCCTGTGGCTGCTGGGGTGGG - Intronic
1062214976 9:135384260-135384282 TTGCCTGTGGCTTCCTGGACGGG - Intergenic
1062322806 9:135998575-135998597 GCGCCTGTGCCTCCCTGGAGCGG - Intergenic
1062325384 9:136010266-136010288 GTGCCTGAGGCTGCAGGCAGGGG - Exonic
1062497986 9:136840559-136840581 GTGCCTGTCACTGCCTGGGGAGG + Exonic
1062668521 9:137692798-137692820 GTGTCTGTTGCTGCTGGGTGTGG + Intronic
1186468523 X:9803460-9803482 GTGCCAGAGGCTGGGTGGAGAGG + Intronic
1190687746 X:52889519-52889541 GTGGCTGTGGCAGGCTGGAGTGG - Intergenic
1190698236 X:52966273-52966295 GTGGCTGTGGCAGGCTGGAGTGG + Intronic
1191616408 X:63174648-63174670 ATGCCCGTGGCTGCATGGATAGG - Intergenic
1191619889 X:63204275-63204297 ATGCCCGTGGCTGCATGGATAGG + Intergenic
1191727452 X:64296296-64296318 CTGCCAGGGGCTGCTGGGAGGGG + Intronic
1195297336 X:103491918-103491940 GTTCCTGTGGCTGTTTGGACTGG + Intergenic
1196458061 X:115903683-115903705 CTTCCTGTGGTTGCTTGGGGAGG - Intergenic
1196458506 X:115906427-115906449 TTCCCTGTGGTTGCTTGGGGAGG - Intergenic
1197309222 X:124883700-124883722 GTGGCTGTGGCAGGTTGGACAGG + Intronic
1197804304 X:130384640-130384662 GTACCTGTGGCTGCTCGGCGTGG - Exonic
1198367041 X:135951495-135951517 GAGGCTGTGGCTGGTTGGACAGG + Intergenic
1199175967 X:144787349-144787371 GTGGCTGTGGCTGCAGGGTGAGG + Intergenic
1200871539 Y:8104605-8104627 GTGCCTGGGGCTGTTTGGGTAGG - Intergenic
1201169515 Y:11243633-11243655 GTCCCTGTGGCTGTTAGGTGGGG + Intergenic
1201637224 Y:16137073-16137095 GTGCCTGCTGCTGATTGGATGGG - Intergenic
1202244487 Y:22804905-22804927 GTGCCTGGGGCTGTTTGGGTAGG + Intergenic
1202397476 Y:24438651-24438673 GTGCCTGGGGCTGTTTGGGTAGG + Intergenic
1202473305 Y:25231436-25231458 GTGCCTGGGGCTGTTTGGGTAGG - Intergenic