ID: 1077523522

View in Genome Browser
Species Human (GRCh38)
Location 11:3050330-3050352
Sequence TCTGGGTGCCTGTGGCTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 407}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077523522_1077523528 13 Left 1077523522 11:3050330-3050352 CCAAGCAGCCACAGGCACCCAGA 0: 1
1: 0
2: 2
3: 40
4: 407
Right 1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG 0: 1
1: 0
2: 1
3: 3
4: 87
1077523522_1077523524 -10 Left 1077523522 11:3050330-3050352 CCAAGCAGCCACAGGCACCCAGA 0: 1
1: 0
2: 2
3: 40
4: 407
Right 1077523524 11:3050343-3050365 GGCACCCAGAAGCAAAGCTCTGG 0: 1
1: 0
2: 3
3: 34
4: 532
1077523522_1077523525 -9 Left 1077523522 11:3050330-3050352 CCAAGCAGCCACAGGCACCCAGA 0: 1
1: 0
2: 2
3: 40
4: 407
Right 1077523525 11:3050344-3050366 GCACCCAGAAGCAAAGCTCTGGG 0: 1
1: 0
2: 3
3: 23
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077523522 Original CRISPR TCTGGGTGCCTGTGGCTGCT TGG (reversed) Intronic
901154627 1:7127203-7127225 TCTGGGTGCTTGTGGCTCCAGGG + Intronic
901987931 1:13091031-13091053 TCGGGGTCCCTGTGCCTGCCTGG - Intergenic
901993881 1:13135736-13135758 TCGGGGTCCCTGTGCCTGCCTGG + Intergenic
902226141 1:14997617-14997639 TCTGGGTGTGTGAGGCTGCTGGG - Intronic
902612043 1:17603155-17603177 CCTGGGTGACTGAGGATGCTAGG + Intronic
902699282 1:18160765-18160787 TCTGGGTGGCTGCGGGTGCAGGG - Intronic
903735200 1:25525582-25525604 TTGGGGTTCCTGTGGCTGCAAGG - Intergenic
904318889 1:29683767-29683789 TCTGGGTGCCTGGGTCTTCATGG + Intergenic
904799206 1:33081154-33081176 CGTGGGGGTCTGTGGCTGCTGGG + Exonic
904855381 1:33493941-33493963 ACAGGTTGGCTGTGGCTGCTGGG + Intronic
904860320 1:33533032-33533054 CCTGGGTGAGTGTGCCTGCTCGG - Exonic
904918403 1:33986696-33986718 TCTGAGAGACTGTGGCAGCTTGG - Intronic
908000538 1:59674094-59674116 TCTGGGTGCCTGTGCCTCAGGGG + Exonic
910982475 1:92972829-92972851 TCTGCCTGCCTTTGGCTTCTAGG - Intergenic
912127844 1:106562265-106562287 TTTGGTTGCCTGTGGTTGTTGGG - Intergenic
912435022 1:109655884-109655906 TCTGGGAGACTGAGGCTGCCAGG - Intergenic
912645986 1:111392105-111392127 CCTTGGTGCCTGTGTCTACTGGG + Intergenic
912978344 1:114349337-114349359 CCTGGGGGCCTGAGGCTGTTTGG - Intergenic
913172282 1:116243735-116243757 TCTGCATGCCTGTGGGGGCTGGG + Intergenic
914799627 1:150951052-150951074 TCTGGTTGGCTGTGACTGCAAGG + Exonic
915467580 1:156106420-156106442 TCTGTGTGTGTGTGGTTGCTGGG - Intronic
915625775 1:157113289-157113311 CCTGCCTGCCTGTGGCTGGTGGG + Intergenic
919901044 1:202044620-202044642 TCTGGATCACTCTGGCTGCTGGG - Intergenic
920232222 1:204478237-204478259 TATGGGTGAGTGTGGGTGCTGGG - Intronic
922056911 1:222050199-222050221 GCTGGGTTCCTGAGTCTGCTGGG + Intergenic
922614207 1:226951505-226951527 CCTGGGGGCCTGTGGGTGTTGGG + Intronic
922710748 1:227829031-227829053 TTTGGGTCCATGTGGCTCCTGGG + Intronic
922795925 1:228339827-228339849 GCTGGGGCCCTGTGGCTCCTGGG - Intronic
922876375 1:228942919-228942941 TCTCTGTACCTGTGGGTGCTGGG + Intergenic
923034108 1:230272192-230272214 CGTGAGTGCCTGTGGGTGCTTGG + Intronic
923685414 1:236150048-236150070 TCTGTGTGCCTGTGTCTGTGTGG + Intronic
1063197929 10:3760252-3760274 TCTGGGGGCCTCTGGGTGCCCGG + Intergenic
1063722960 10:8602913-8602935 TCTGGATGCCTCTGTCTGGTTGG + Intergenic
1065937620 10:30534811-30534833 TCTGCGTGGCTGTGGCTGAGGGG - Intergenic
1066287057 10:33978605-33978627 TCTAGTTACCTGTGGCAGCTTGG + Intergenic
1066354803 10:34672371-34672393 CCTGGGAACCTGTAGCTGCTTGG - Intronic
1067293735 10:44962583-44962605 TCTGGGTGCCTGCTGCTGCAGGG - Intronic
1067433883 10:46264107-46264129 TCTGTGTGCCTGTGGCAGGCAGG + Intergenic
1067439805 10:46302201-46302223 TCTGTGTGCCTGTGGCAGGCAGG - Intronic
1067581956 10:47451783-47451805 TCTGTGTGCCTGTGGCAGGCAGG - Intergenic
1067700497 10:48568109-48568131 TCTGGGGACCTTGGGCTGCTGGG + Intronic
1069745079 10:70709959-70709981 TCAGGGTGCCTGTGGCTGTGTGG + Intronic
1070579947 10:77711550-77711572 TCAGCGTGGCTGTGGCGGCTCGG - Intergenic
1070720721 10:78755167-78755189 TCAGGGTGCCTGCCCCTGCTTGG + Intergenic
1070819487 10:79346674-79346696 TGAGGGTGGCTCTGGCTGCTGGG + Intergenic
1072151581 10:92689350-92689372 CCTGGGTTCCTAGGGCTGCTCGG - Intergenic
1073689709 10:105794371-105794393 TCTGTGTGTCTGTGTCTACTGGG + Intergenic
1073777001 10:106797740-106797762 TCTGGGAGCATCTGGCTGCATGG - Intronic
1076315846 10:129540931-129540953 GCTGAGTGACAGTGGCTGCTGGG + Intronic
1076362726 10:129900801-129900823 CCAGGTTGCCTGTGGCTGATGGG - Intronic
1076698267 10:132257388-132257410 CCTAGGGGCCTGTGGCTGCCAGG - Intronic
1076787903 10:132760191-132760213 TTTGAGGGCCTGGGGCTGCTGGG - Intronic
1076838158 10:133031726-133031748 GATGAGTGCCTGTGGTTGCTGGG - Intergenic
1076846772 10:133073107-133073129 GCTGGGTGCCCAGGGCTGCTGGG + Intronic
1076861156 10:133139123-133139145 TCTGGGTACCTGTGGCGGGGGGG + Intergenic
1076861194 10:133139230-133139252 TCTGGGTCCCTGTGGTTGGGGGG + Intergenic
1077156832 11:1095835-1095857 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077156853 11:1095904-1095926 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077156930 11:1096180-1096202 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077156968 11:1096318-1096340 TCTGTGTGCCAGTGGGTGGTGGG - Intergenic
1077156988 11:1096387-1096409 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157011 11:1096456-1096478 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157047 11:1096594-1096616 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157096 11:1096771-1096793 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157117 11:1096840-1096862 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157135 11:1096909-1096931 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157154 11:1096978-1097000 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157175 11:1097047-1097069 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157192 11:1097116-1097138 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157214 11:1097185-1097207 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157235 11:1097254-1097276 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157254 11:1097323-1097345 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157273 11:1097392-1097414 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157315 11:1097530-1097552 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157335 11:1097599-1097621 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157354 11:1097668-1097690 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157376 11:1097737-1097759 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157397 11:1097806-1097828 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157416 11:1097875-1097897 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157435 11:1097944-1097966 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157458 11:1098013-1098035 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157477 11:1098082-1098104 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157498 11:1098151-1098173 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157581 11:1098437-1098459 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157600 11:1098506-1098528 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157642 11:1098644-1098666 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157663 11:1098713-1098735 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157680 11:1098782-1098804 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157702 11:1098851-1098873 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157723 11:1098920-1098942 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157742 11:1098989-1099011 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157761 11:1099058-1099080 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157803 11:1099196-1099218 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157842 11:1099334-1099356 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157861 11:1099403-1099425 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157883 11:1099472-1099494 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077157935 11:1099679-1099701 TCTGTGTGCCGGTGGGTGTTGGG - Intergenic
1077273492 11:1692705-1692727 CCTGGGTGTCTGTGGCTTCCTGG - Intergenic
1077523522 11:3050330-3050352 TCTGGGTGCCTGTGGCTGCTTGG - Intronic
1077566238 11:3302398-3302420 TCTGGGTTTCTGGCGCTGCTGGG + Intergenic
1078083612 11:8220764-8220786 ACTGGCTGCCTGTGGCACCTGGG - Intergenic
1078328588 11:10400504-10400526 AGTGGGTGTCTGGGGCTGCTTGG - Intronic
1078755323 11:14203543-14203565 TCTGGGTGACTGTGTGTGATTGG - Intronic
1080671147 11:34379337-34379359 TCTGGGTGACTCTGGCAGCTGGG + Intergenic
1081867380 11:46367151-46367173 TCTTAGTGTCTGGGGCTGCTGGG + Intronic
1082003989 11:47409742-47409764 GCTGGGTGTCTCTGGCTGCCAGG - Intronic
1083308446 11:61772573-61772595 CCTGGGGGCATCTGGCTGCTGGG + Intronic
1083421574 11:62556285-62556307 TGTGGATGTCTGTGGTTGCTGGG - Intergenic
1083724612 11:64621699-64621721 TCTGGCAGCCTATGGCTGTTAGG - Intronic
1084194187 11:67514845-67514867 TCTGGGTGCTTGTTGCTAGTGGG - Intergenic
1084700777 11:70785064-70785086 CCTGTGTGCCTGCAGCTGCTAGG + Intronic
1084888933 11:72227136-72227158 TCAGATTGCCTGTGCCTGCTGGG - Intronic
1084912077 11:72398194-72398216 TAGTGGGGCCTGTGGCTGCTTGG + Intronic
1084952483 11:72674291-72674313 TCTTGGTCCCTGTGCCTGCTGGG - Exonic
1085970728 11:81587627-81587649 TCTTGGTGCCTTTGCCTCCTGGG - Intergenic
1089006686 11:115097538-115097560 CCTGGGTTCCTGTGGCTCGTGGG + Intergenic
1089317907 11:117604820-117604842 TCTGTCTGCCCGTGGCTCCTTGG + Intronic
1089528101 11:119109906-119109928 TCCAGGGGCCTGTAGCTGCTAGG - Intronic
1090949127 11:131457370-131457392 TTTGGGTTCCTGTGGCTTCTCGG - Intronic
1091285262 11:134405282-134405304 TCTGGGTCCCCGTAGCTGATGGG - Intronic
1091314181 11:134599380-134599402 GCTGTTTGCCTTTGGCTGCTGGG - Intergenic
1091582548 12:1798088-1798110 ACCGGGTGGCTGTGGCTTCTGGG - Intronic
1091829601 12:3540382-3540404 TCTAGGTGTGTGTGGCTCCTCGG + Intronic
1094661143 12:32471733-32471755 GCTGGGACCCGGTGGCTGCTTGG + Intronic
1095048445 12:37535126-37535148 GCTAGGTGCCTGAGCCTGCTTGG + Intergenic
1095800560 12:46267567-46267589 ACTGGGTCCCAGTGGGTGCTGGG + Exonic
1096604496 12:52754929-52754951 TCTGTCTGCCTGTGGCTCCCTGG + Intergenic
1096908721 12:54961203-54961225 TGGGGGTGCCTGGGTCTGCTGGG + Exonic
1097276338 12:57815901-57815923 TCTGGCTGCCTGGGGCTGCTAGG - Intronic
1099055007 12:77828565-77828587 TCTCGGTGCCTTTGTCTCCTAGG + Intergenic
1100947000 12:99796505-99796527 CCTGGGTTCCAGTGGCAGCTTGG + Intronic
1101762274 12:107668715-107668737 TTTGGGGACCTGAGGCTGCTGGG - Intergenic
1102259725 12:111436655-111436677 TCTGGGTGTCTGTCGCTGTAGGG + Intronic
1102495364 12:113315613-113315635 CCTGGTTGCCTCTGGCTACTGGG + Intronic
1103952276 12:124557811-124557833 TCTGTGTGGCGGTGGCTCCTGGG - Intronic
1104463056 12:128970476-128970498 ACTTGGTGCCTGTGGCTGCGGGG - Intronic
1104685358 12:130781129-130781151 ACATGGAGCCTGTGGCTGCTCGG + Intergenic
1104821284 12:131679012-131679034 TCTGGGGGCCTGTGGGGGTTTGG - Intergenic
1105007405 12:132729727-132729749 TCCTCGTGCCTGGGGCTGCTGGG + Exonic
1105750173 13:23416035-23416057 TCTGGGGGGCTGAGGCTGTTAGG + Intronic
1105754326 13:23451205-23451227 TCTGGGTGCTTGGGGCTGTGGGG - Intergenic
1105934054 13:25082034-25082056 TCTGGTTGCCTTTGGCCACTGGG + Intergenic
1109653055 13:65353737-65353759 GCTTGGTGCCTGTGGCTGTAGGG - Intergenic
1110975797 13:81832678-81832700 TCTGTGTACCTGTGTCTGCAGGG + Intergenic
1111237054 13:85423028-85423050 TCTGGGTGCCTATAACTGCTGGG - Intergenic
1111721235 13:91947812-91947834 TCTGGGTTGCTGTTGCTGCAGGG - Intronic
1113665677 13:112140526-112140548 CCTGGGTGGCTGTGTCTGCCGGG + Intergenic
1113948709 13:114059426-114059448 CCTGGGTACCTGTGCCTCCTGGG - Intronic
1114484671 14:23055679-23055701 GCTGGGTGGCTGGGGCTGCATGG - Exonic
1118952157 14:70444851-70444873 TCTGATGGCCTGGGGCTGCTTGG - Intergenic
1119306327 14:73610884-73610906 TCTGGGGTCATGTGACTGCTGGG - Intergenic
1119406619 14:74403112-74403134 TCTGGCTGCCTGAGGCCCCTGGG - Intergenic
1120215402 14:81676700-81676722 TCTGGGTGCCTCAAACTGCTCGG + Intergenic
1121911564 14:97796765-97796787 TCTGGGCCCCTGGGGCTACTGGG - Intergenic
1122276469 14:100593244-100593266 TGTGTGTGCCTGTGGGTGGTCGG - Intergenic
1122626464 14:103087717-103087739 TCTGGGTGCAGGAGGCAGCTGGG + Intergenic
1122800175 14:104225439-104225461 TGTGGCTCCCTGGGGCTGCTCGG + Intergenic
1122800242 14:104225719-104225741 TGTGGCTCCCTGGGGCTGCTCGG + Intergenic
1123097736 14:105774359-105774381 CCTGTGCACCTGTGGCTGCTTGG + Intergenic
1124177760 15:27442119-27442141 TCTGAGTTCCTGGGGCTGCTGGG + Intronic
1124336121 15:28858386-28858408 TCTGGGAGCTTGTGGTTGGTTGG + Intergenic
1125135049 15:36331810-36331832 TCTGGGTTTTTGTGGTTGCTTGG + Intergenic
1127324347 15:57880843-57880865 GCTGAGTGCCTGAGGCTGCAAGG - Intergenic
1127464315 15:59228968-59228990 TCTCTGTGCCTGGTGCTGCTGGG - Intronic
1127801888 15:62484159-62484181 TCAGGGTGGGTGTGGCTGCTGGG + Intronic
1127995438 15:64151210-64151232 TGGGGGGGCCTGTGGATGCTGGG + Intergenic
1128127186 15:65201840-65201862 TCTGGGTCCCTGGGGCCCCTGGG - Intronic
1128412257 15:67411279-67411301 TCTGGCTGCCTCTGACTCCTGGG - Intronic
1129112833 15:73347903-73347925 TCTGGAAGCCTGGGGCTGCTGGG - Intronic
1129251749 15:74312975-74312997 GCTGGCTGCCTCTGGGTGCTGGG + Intronic
1129694579 15:77733368-77733390 TCTTGCTGGCTGTGGCTGCCTGG + Intronic
1130082585 15:80747411-80747433 TCTTGGTGGCAGTTGCTGCTGGG + Intronic
1130546781 15:84862678-84862700 TCTGGCTGACTCTGGCTGCTGGG + Exonic
1132713140 16:1278141-1278163 TCAGGGTGCCTGTGACCTCTTGG - Intergenic
1132783993 16:1644371-1644393 TCTGGGTGCCTGTGTGTGCCTGG + Intronic
1134116626 16:11553533-11553555 TGCGGGAGCCTGTGCCTGCTGGG - Exonic
1135188900 16:20338389-20338411 TCTGGGTGAGTGTGGGAGCTGGG - Intronic
1136592237 16:31224450-31224472 TCGCAGGGCCTGTGGCTGCTGGG + Exonic
1137579071 16:49622392-49622414 TCTGGGGGGCTGTAGGTGCTTGG - Intronic
1138349457 16:56338755-56338777 GCTCAGGGCCTGTGGCTGCTAGG - Intronic
1139289935 16:65848774-65848796 TCTGGCTGACTGTGTCTGCAAGG - Intergenic
1139450398 16:67024599-67024621 TCTGGGTGCCTGGGGATGGCAGG - Intergenic
1140345953 16:74213302-74213324 CCTCGGTGGCTGTGGCTTCTTGG - Intergenic
1142144314 16:88486462-88486484 GCTGGGTGCAAGTGGGTGCTGGG + Intronic
1142144322 16:88486501-88486523 GCTGGGTGCAAGTGGGTGCTGGG + Intronic
1142144378 16:88486767-88486789 ACTGGGTGCAAGTGGGTGCTGGG + Intronic
1142144392 16:88486842-88486864 GCTGGGTGCAAGTGGGTGCTGGG + Intronic
1142148054 16:88500757-88500779 TCAGGCTCCCTGGGGCTGCTGGG + Intronic
1143082800 17:4394159-4394181 TCTGGGTCCATCCGGCTGCTCGG - Intergenic
1144217020 17:13065251-13065273 TCTGGGTGCGGCTGGCTTCTTGG - Intergenic
1145241766 17:21244266-21244288 TCTTGGTGCCTGAGTCCGCTGGG - Intronic
1146493541 17:33300116-33300138 ACTGGGTGGCTGTGGGGGCTGGG - Intronic
1147331572 17:39702316-39702338 TCTGGGTGCTGGAGGCAGCTGGG - Intronic
1147470874 17:40659773-40659795 TCTAGGTGACTTTGGCTGTTTGG + Intronic
1147586666 17:41657038-41657060 TCTGGGTCCCTGTGGCATCTGGG + Intergenic
1147595636 17:41715516-41715538 TAAGGGTGCATCTGGCTGCTGGG - Exonic
1147654636 17:42081886-42081908 TCTGGGCACCTGTTGATGCTGGG - Intergenic
1148106098 17:45119822-45119844 TCTGTGTGCATGTGGATGGTGGG - Intronic
1148331602 17:46817130-46817152 TCTGGGTGTTTGGGGCTCCTGGG - Intronic
1148693336 17:49545369-49545391 TCTGGGTGCCTGTCCCTGGATGG + Intergenic
1148742463 17:49900643-49900665 CCTGGGAGCCTGGAGCTGCTGGG + Intergenic
1149521117 17:57318950-57318972 TATTGGTGCCTGTGGCTCCAGGG + Intronic
1149821737 17:59786538-59786560 TCTGGGTGTCAGTTGTTGCTGGG + Intronic
1150131776 17:62673255-62673277 GCTGGGGGCCTGTGGATACTGGG + Intronic
1150345823 17:64403943-64403965 TCTGCCTGCCTGTGTCTGCCTGG + Intronic
1150461484 17:65357194-65357216 TGTGTGTGGCTGTGGCTGTTGGG + Intergenic
1150552279 17:66221734-66221756 TCTGGGTTCCTGAAGCTACTTGG - Intronic
1151199261 17:72455752-72455774 TCTGGGTGCCTGTGGGCGCTGGG - Intergenic
1152422545 17:80201952-80201974 TCTGGGGGTCCCTGGCTGCTGGG - Intronic
1152582148 17:81170886-81170908 CCTGGGTGCCTGTGGGTACAGGG - Intergenic
1152638752 17:81440843-81440865 TCTGGGTGTCTCAGGCTGCTGGG - Intronic
1152690385 17:81715367-81715389 TCAGGGTCCCTGTGGCCCCTCGG + Intronic
1152747903 17:82049641-82049663 TCTGGGTGCCTCTGCCACCTGGG - Intronic
1152750445 17:82060140-82060162 CCCGTGTGGCTGTGGCTGCTGGG - Intronic
1153682306 18:7512095-7512117 TCTGGGGTCCTGCGGCTCCTGGG + Intergenic
1153801708 18:8676542-8676564 TCTGGGTCTCTATGGTTGCTCGG + Intergenic
1154408035 18:14114168-14114190 TTTGGTTGCCTGTGCCTGCAGGG + Intronic
1156943049 18:42794212-42794234 TCTGACTGCTTGTGTCTGCTAGG - Intronic
1158198833 18:54917712-54917734 TCTGTGTGACTGTGTGTGCTGGG - Intronic
1158864131 18:61620670-61620692 TCTGGTGGCCTGTGACTCCTTGG + Intergenic
1160017233 18:75154234-75154256 CCTGTGAGCCTGTGGCTTCTGGG + Intergenic
1160023449 18:75199590-75199612 TCCGTGTGGCTGTGGCTGTTAGG + Exonic
1160205911 18:76831549-76831571 TCTCGGGGACTGTGACTGCTGGG + Intronic
1160238130 18:77101846-77101868 TTTAGGTGCCGTTGGCTGCTGGG - Intronic
1160346964 18:78140016-78140038 TCTTGATGCCAGTTGCTGCTGGG - Intergenic
1160894924 19:1397852-1397874 GCTGGGTGCCTGTGGCCCCTGGG - Intronic
1161007476 19:1943822-1943844 CCTGGGGGCCTGGGGCAGCTCGG - Intronic
1161374213 19:3930965-3930987 TGGGGATGACTGTGGCTGCTGGG - Intergenic
1161504829 19:4638454-4638476 TCTGGGTCCCGGTTGCAGCTAGG - Intergenic
1161813062 19:6481739-6481761 CCTGGGGGCCTGTGTATGCTGGG + Exonic
1162813498 19:13179231-13179253 GGTGGGTGCCAGGGGCTGCTGGG - Intergenic
1163173361 19:15548362-15548384 TCTGTGTGCCTGTTGCTTCTGGG + Intronic
1163398964 19:17080240-17080262 GCTGGGTGCCTGAGTTTGCTAGG + Intronic
1163615339 19:18323930-18323952 CCTGGGTTCTGGTGGCTGCTGGG + Intergenic
1164945598 19:32290649-32290671 TCTGGGATCCTGTGGGAGCTGGG - Intergenic
1165774052 19:38394793-38394815 CCTGGGAGCCTGGGGCTCCTGGG + Intronic
1166203931 19:41256677-41256699 CCTGGGTGGCTGTGGATGCAAGG + Intronic
1166947815 19:46407840-46407862 TCTGTGTGTCTGTGACTGCCTGG + Intergenic
1168281772 19:55309766-55309788 TCTGGCTACCTCTGGTTGCTTGG - Intronic
1168333907 19:55586059-55586081 TCTGGGTGCTGGAGGCTGCACGG - Intergenic
925780680 2:7378938-7378960 TGTGTGTGCGTGTGGCTGCCTGG + Intergenic
926710060 2:15872096-15872118 TCTGGTTTCCTGTGGGTGCCTGG - Intergenic
927148421 2:20181637-20181659 TCTGTCTGCCTCTGCCTGCTGGG + Intergenic
927484013 2:23476787-23476809 TCTGGCTGCCTGATCCTGCTTGG - Intronic
929776615 2:44934426-44934448 TCGGGGAGCCTGTGGCTGGGCGG + Intergenic
929953252 2:46433744-46433766 TCTAGGTGCCTGGCTCTGCTTGG - Intronic
930694513 2:54397543-54397565 TCCTGGTGCCTGTGTATGCTTGG - Intergenic
930873923 2:56192967-56192989 TCTGGGTTTCTGTGGATGCTCGG - Exonic
931463623 2:62468564-62468586 TGTGGGTGCATGTGGGTGTTGGG + Intergenic
931712279 2:64998622-64998644 TCGGTGTGCCAGTGGCTGTTAGG + Intronic
932570846 2:72937614-72937636 TGTGGGTGCCTGTGGGCGTTCGG + Intergenic
932617581 2:73244262-73244284 TCTATGTGCCTGGGGCTGTTTGG + Intronic
933704986 2:85283103-85283125 TCTGGGAGCCTCTGCCTCCTTGG + Intronic
934769464 2:96898736-96898758 TCTGAGGGCCTTGGGCTGCTAGG + Intronic
935099850 2:99983076-99983098 TCCAGGTGTCTGTGGCTGATTGG + Intronic
935331865 2:101983102-101983124 TCTTGGTGACTTTGGCTGTTGGG + Intergenic
937005439 2:118508310-118508332 TCTGGGTGTCTCTGGCTCCATGG - Intergenic
937289065 2:120771020-120771042 TCTGGCTGCCTGTGGCTCTGTGG + Intronic
937926277 2:127170152-127170174 CCTGGGTGCCTGCTGCTGGTGGG + Intergenic
938125334 2:128667001-128667023 TCTGGGAGACTGTGTATGCTCGG - Intergenic
939052050 2:137318918-137318940 AGCGGGTGCCTGTGGCTACTTGG - Intronic
940176425 2:150882193-150882215 TGTGTGGGCCTGTGGCTGGTTGG - Intergenic
941575559 2:167225852-167225874 TCTTGGTGCCTGTGGCTGAGTGG + Intronic
944288007 2:197973874-197973896 TCTTGGTTCCTCTGGCTGCTAGG + Intronic
946174309 2:217913202-217913224 TCTGGTGGCCTGGGCCTGCTGGG - Intronic
947178775 2:227393700-227393722 TCTGGGGGCCTTTTGCAGCTCGG + Intergenic
948464536 2:238145883-238145905 TCTCGGTTCCTGTTGCTGCAGGG - Intronic
948536999 2:238653885-238653907 TGTGGGTGACTGTGGGTGGTGGG + Intergenic
948591126 2:239050914-239050936 TTTTGGAGCCTGTGGCTGCAAGG - Exonic
948760076 2:240184867-240184889 TGTGGGTGCCTCTGGCTCCAGGG - Intergenic
948803698 2:240444027-240444049 TCTGGGTGCCTGCACCTGCGGGG - Intronic
948873877 2:240817454-240817476 TCTGGGTGGCTGTGATTGGTAGG - Intronic
948971230 2:241428807-241428829 TCTGGATACCAGTGGTTGCTGGG - Intronic
1169091953 20:2866324-2866346 ACTGAGGGCCTGTGGGTGCTGGG + Intronic
1169118962 20:3084120-3084142 CCTGGGCGCCTGTGGCTGGGAGG + Intronic
1169461996 20:5803517-5803539 TGTGGGAGCCTGTGGCTTCAGGG + Intronic
1173701386 20:45074931-45074953 TCTGGGTGCCTGGGAAGGCTGGG + Intronic
1174435399 20:50502976-50502998 GCTGTGAGCCTGGGGCTGCTGGG + Intergenic
1174505383 20:51014461-51014483 TCTGAGGGTCTGTGGATGCTTGG + Intronic
1174848483 20:53967741-53967763 TCTGAGTGTCTGTGGCGGCTTGG + Intronic
1175186464 20:57182342-57182364 TCTGGTGGCCTGGGGGTGCTGGG - Intronic
1175249711 20:57601793-57601815 TGTGGGGGCCTGGAGCTGCTGGG + Intergenic
1175418845 20:58818633-58818655 TCTGTGTATCTGGGGCTGCTAGG - Intergenic
1175799285 20:61792019-61792041 CCTGGATGCCTTTGGCTGCCTGG + Intronic
1176162888 20:63657535-63657557 GCTGGGTGCCAGTGAGTGCTGGG + Intergenic
1176276859 20:64277536-64277558 TCTGGTTCCCTGCTGCTGCTGGG + Intronic
1176312392 21:5159201-5159223 TCTCCATGCCAGTGGCTGCTCGG - Intergenic
1176672857 21:9750903-9750925 GCTGGGTGGTTGTGGCTGCAAGG - Intergenic
1178671412 21:34594769-34594791 TATGGGGGCCAGTGCCTGCTTGG - Intronic
1179303338 21:40132650-40132672 AGTGGATGCCTGGGGCTGCTCGG + Intronic
1179499837 21:41801303-41801325 TGGGGGTGCCTGCGGCTGCGAGG + Exonic
1179721191 21:43316766-43316788 TCTAGGTGGCAGTGGCTGCCAGG - Intergenic
1179844656 21:44102829-44102851 TCTCCATGCCAGTGGCTGCTCGG + Exonic
1179960167 21:44763668-44763690 GCTGGGTGCCTGGGTGTGCTGGG - Intergenic
1179983764 21:44910201-44910223 TCTGGGTGCCACTGGCTTCAGGG + Intronic
1180048459 21:45320577-45320599 TCTGGGTGCCTGCTGCATCTGGG - Intergenic
1180080589 21:45485974-45485996 TCAGGGAGCTTGTGGCTGCGAGG + Intronic
1180091060 21:45534041-45534063 CTTGGGTGCCTGGTGCTGCTGGG - Intronic
1180147392 21:45928965-45928987 ACTGGAGGCCTGTGGCTCCTGGG + Intronic
1181019312 22:20090475-20090497 TCTGCATGGCTGAGGCTGCTGGG + Intronic
1181751316 22:24990967-24990989 CCTGGGTGACTGGAGCTGCTTGG - Intronic
1183500764 22:38177405-38177427 TCTGGCGCCCTGTGGGTGCTGGG - Intronic
1183963352 22:41426197-41426219 TCTGGGTGCATATAGCTCCTCGG + Intergenic
1184303539 22:43578404-43578426 TCTGGGTTGCTGTGGCTGTTTGG + Intronic
1184377243 22:44121661-44121683 TATGGGTGCTTGTGGCTCCTGGG + Intronic
1184807762 22:46806786-46806808 GGTGAGTGCCTGTGGCTGGTGGG + Intronic
1184838839 22:47040614-47040636 CCTGGGTGCATGAGGCTGCTGGG + Intronic
1185012474 22:48322208-48322230 TCTGGGTGCCTGTGAGTCCTAGG + Intergenic
1185012527 22:48322382-48322404 TCTGGGTGCCTGTGAGTCCCAGG + Intergenic
1185012562 22:48322510-48322532 TCTGGGTGCCTGTGAGTCCTAGG + Intergenic
949865315 3:8542392-8542414 ATTGGGTGTCTGTGGCTGCAGGG - Intronic
950205965 3:11081088-11081110 TCTGGCTGCTTGTATCTGCTTGG + Intergenic
950271869 3:11623120-11623142 TGTGGGTTCCTGTGGATGCTAGG - Intronic
950332809 3:12169893-12169915 GCTGCTTACCTGTGGCTGCTGGG - Exonic
951619570 3:24586597-24586619 TCTGGGTGCCAGTGGGAACTTGG + Intergenic
952338247 3:32423496-32423518 TCTCGGTTTCTGTGGCTACTGGG + Intronic
953031702 3:39184055-39184077 CCTGGGTGGCTCTGCCTGCTCGG + Exonic
954258611 3:49422918-49422940 GCTGGCTGCCTGTGTCTGCCTGG - Intergenic
954645421 3:52128538-52128560 TCTGAGTGCCCTGGGCTGCTAGG - Intronic
954674196 3:52306756-52306778 TCTGGGTTCCTGGGGCTGGAGGG - Intergenic
954686475 3:52372851-52372873 ACCTGGTGCCTGTGGGTGCTGGG + Intronic
956435606 3:69231937-69231959 TCTGGGAGCCTGAGGCTGCAAGG + Intronic
956711453 3:72041912-72041934 GCTGTGTACCTGGGGCTGCTGGG - Intergenic
961731427 3:128967985-128968007 TCAGGGGGCTTGTGTCTGCTGGG - Exonic
961827111 3:129605037-129605059 CCTGGGTACCTGTGGCAACTTGG + Intronic
962060810 3:131925289-131925311 TCTGGGCGGCTCTGGCTCCTTGG - Intronic
962874427 3:139524974-139524996 TCAGGCTGCCTGTGGGAGCTGGG - Intronic
963074528 3:141333699-141333721 TCTGGGTCCATGAGGGTGCTAGG - Intronic
964151872 3:153535284-153535306 TTTGGTTGCCTGTGCCTGTTGGG - Intergenic
964961440 3:162432774-162432796 TTTGGTTGCCTGTGCTTGCTAGG - Intergenic
966040479 3:175480141-175480163 TCTAGGTGCCTCTGGTTTCTAGG + Intronic
966355520 3:179074472-179074494 ACTGGGTGTGTGTGGCTGGTGGG - Intergenic
966415889 3:179689124-179689146 TCTCGACACCTGTGGCTGCTTGG + Intronic
966642342 3:182204907-182204929 TCTGGGAGCCTGGCTCTGCTAGG - Intergenic
968467693 4:760745-760767 GCAGGGAGCCCGTGGCTGCTGGG + Intronic
968503066 4:960133-960155 ACTGGCAGCCTGTGTCTGCTGGG + Exonic
968679286 4:1905581-1905603 TGTGGGAGCAGGTGGCTGCTAGG + Intronic
968857094 4:3133928-3133950 CCTGGGTGCTTGGGGCTGCAGGG + Intronic
969304240 4:6316760-6316782 TCTGTGTGCCTGTGGCAGAGTGG + Intergenic
969338645 4:6527101-6527123 TCAGGGTGGCTGAGGCTGCCTGG - Intronic
969597669 4:8158292-8158314 TCTGCGTGCCTAGGTCTGCTGGG + Intronic
969634347 4:8357892-8357914 TTTGGGTCCCGGTGGCTGCAAGG - Intergenic
969640543 4:8395714-8395736 TCTGGGTGCCAAGGGCAGCTCGG - Intronic
970912161 4:21289841-21289863 AGTGGGAGTCTGTGGCTGCTTGG - Intronic
972451667 4:39206364-39206386 TTTAGGTGCCTGTGGGTCCTTGG - Intronic
973829812 4:54747398-54747420 TCTGGGTGCCTGTTTATCCTTGG - Intergenic
974034672 4:56807489-56807511 TTTGGGTGCCTCTGGAGGCTAGG + Intergenic
974576336 4:63728612-63728634 TCTTGTTTCCTGTGTCTGCTGGG + Intergenic
976493056 4:85693820-85693842 CATGGGTGCCTATGGCCGCTAGG + Intronic
977716606 4:100190404-100190426 GCAGGGTGCCGCTGGCTGCTGGG - Exonic
978595167 4:110369467-110369489 TCTGGATGCCTGTTGCTAGTCGG - Intronic
979280414 4:118861061-118861083 TTTGGTTGCCTGTGCCTGCCAGG + Intronic
980385116 4:132079054-132079076 TCTGGGTAGTTGTGGCTGCAAGG - Intergenic
982675953 4:158376069-158376091 TCTGTGTGTCTGTGCATGCTGGG + Intronic
984016638 4:174434576-174434598 AATGGTTTCCTGTGGCTGCTGGG + Intergenic
985102408 4:186471531-186471553 TTTGGGAGCCTGGAGCTGCTTGG - Intronic
985401833 4:189600723-189600745 GCTGGGTGGTTGTGGCTGCAAGG + Intergenic
985690036 5:1303131-1303153 TTTGGTTGCCTGTGCCTGCAGGG + Intergenic
985852240 5:2397316-2397338 TCTGGAAGCCTGTGGCTGAGAGG - Intergenic
988967252 5:36432007-36432029 GCTGGGTGCTAGTGGGTGCTGGG + Intergenic
989215036 5:38895673-38895695 TTTGGTTGCCTGTGGTTGTTGGG + Intronic
991642797 5:68771303-68771325 GCTGGGGGCCTGTGCCAGCTTGG - Intergenic
993641625 5:90412893-90412915 TCTGGGAGCCTGAGGCTGGAGGG - Intergenic
997628678 5:135349577-135349599 TCTGGCTGCCTGGCTCTGCTTGG - Intronic
997653244 5:135537197-135537219 TCTGGGCCCCTGTGGCTCCTGGG - Intergenic
998900595 5:146849175-146849197 TCTGGGTGCTAGTTGCTACTGGG + Intronic
999153198 5:149440485-149440507 GCTGAGTGCCTGAGGCTGCAGGG - Intergenic
1002064621 5:176645923-176645945 TCTTGGTGGCTGTGTCTGCATGG - Exonic
1002400634 5:178989973-178989995 TCTGGGTGCAGGTGGCAGCCTGG - Intronic
1002878876 6:1234790-1234812 TCTGGGTGTCACTGGGTGCTGGG - Intergenic
1005087997 6:22026521-22026543 TCTCGGTCACTGTGGCTACTGGG - Intergenic
1006167100 6:32071409-32071431 TGTGGGAGCCTGGGGGTGCTGGG - Intronic
1006417366 6:33912661-33912683 TCTGAGTTCCTGTGGCTCCTGGG + Intergenic
1006639984 6:35484889-35484911 TCAGGGTGCCTAGTGCTGCTCGG - Intronic
1007264689 6:40587607-40587629 CCTGGGCGCCTCTGGCCGCTGGG - Intergenic
1007984204 6:46191094-46191116 TCTCGGGACCTGTGGGTGCTGGG - Intergenic
1008327099 6:50195709-50195731 CCTGAGTGCCTGTCACTGCTTGG + Intergenic
1014215073 6:118745375-118745397 TCTCAGTGCAGGTGGCTGCTTGG - Intergenic
1015093233 6:129384624-129384646 TCTGGGTGCCTAGGGCCTCTAGG + Intronic
1017738968 6:157388155-157388177 TCTAGGTGCCAGTGGTTGTTAGG - Intronic
1018893254 6:167996978-167997000 TCGGGGTCACTCTGGCTGCTCGG + Intronic
1018971971 6:168536268-168536290 TGGGGGAGCCTGTGGCTGCCAGG + Intronic
1018996230 6:168712363-168712385 TCTGGGGGCCTCGGGGTGCTGGG + Intergenic
1019278108 7:186729-186751 TCTGGGAGCCTGGGGGTGCTGGG - Intergenic
1019433737 7:1011405-1011427 TCTGGGTGTCTGTGGGTGTTTGG - Intronic
1019561886 7:1663588-1663610 TCTGGGTACCTCTGTCTGCTGGG + Intergenic
1020464148 7:8457416-8457438 TCAGGGTGCCTGTGACAGCTAGG + Intronic
1022474718 7:30702242-30702264 TCTGGGTGCCTGTCTTAGCTTGG + Intronic
1023905152 7:44516676-44516698 CCCTGGTGCCTGTGTCTGCTGGG + Intronic
1024548295 7:50540112-50540134 TCTGGCTGCATCTGGCAGCTGGG - Intronic
1026863262 7:73807568-73807590 TCTGGGTGGCGGAGGCTGCAGGG + Intronic
1029289437 7:99490943-99490965 TCTGGGTGTAGGTGGCTTCTGGG - Intronic
1030721423 7:112875312-112875334 TCTGGTTGCTTGAGGCTACTTGG + Intronic
1031458789 7:122018891-122018913 TCTGGGTGCCAATCTCTGCTGGG + Intronic
1032016068 7:128381103-128381125 GCTCTGTGCCTGGGGCTGCTGGG + Intergenic
1032475987 7:132211815-132211837 TCTGGGCTCCTGTGGCTCCAGGG - Intronic
1032491721 7:132328941-132328963 TCTGGGTTCCTGGGGAAGCTGGG + Intronic
1033241382 7:139682538-139682560 TCTGGGTCCCTGTGGTGGGTGGG + Intronic
1033413783 7:141144892-141144914 TCAGGGTGGCTGAGGCTGCAGGG + Intronic
1033454406 7:141489661-141489683 TGTGTGTGCCTGTGGCAGCGGGG - Intergenic
1034849717 7:154482178-154482200 TCTTGGTGCAGGAGGCTGCTTGG + Intronic
1034958739 7:155351293-155351315 TCTGGCTGCCAGTGGCTCCCTGG - Intergenic
1035024347 7:155816259-155816281 TCATGGGGCCTGTGGCAGCTTGG - Intergenic
1035331101 7:158098065-158098087 AGTGTGTGCCCGTGGCTGCTGGG + Intronic
1035718228 8:1770263-1770285 TCTGGGTCTCTGCAGCTGCTGGG - Intronic
1036662295 8:10716163-10716185 GCCGGCTTCCTGTGGCTGCTGGG + Intergenic
1037537063 8:19834745-19834767 TCTGGCTGTCTTTGTCTGCTTGG + Intronic
1037579527 8:20236332-20236354 TCCGGGGGCCAGTGGGTGCTGGG + Intergenic
1038584743 8:28778568-28778590 TCTGAGGGGCTGGGGCTGCTGGG - Intronic
1039738142 8:40354853-40354875 TCAGGGTCCCTGTAGCTACTTGG + Intergenic
1041022421 8:53651408-53651430 TCTGGCTGCATGTGGCTACTGGG - Intergenic
1041700990 8:60788679-60788701 CAAGGGTGCCTGAGGCTGCTGGG + Intronic
1043375552 8:79645428-79645450 ACTGGCTGCCTTTGGCTACTAGG - Intronic
1044421204 8:91997749-91997771 TCTGGGGGCCTGTGGCTCTGGGG - Intronic
1049279228 8:141735825-141735847 GCTGGGTCCCTGTGGCTGAGTGG + Intergenic
1049463372 8:142740146-142740168 TGTGGGCACCTGTGCCTGCTGGG - Intergenic
1049623004 8:143606977-143606999 TCTTGGTGTCCGTGGCTGCTGGG - Exonic
1049853856 8:144849502-144849524 TTTGAGTGCCTGGGGTTGCTTGG - Intronic
1051651357 9:19329231-19329253 TGTGGTTGCCTAGGGCTGCTGGG - Intronic
1054740088 9:68797242-68797264 TCTGGGTTCCTGTAGCATCTTGG - Intronic
1056779665 9:89539729-89539751 TATGTGTGCCTGTGTCTGTTGGG + Intergenic
1056922231 9:90801455-90801477 GCTGGGTGTCTGTGGGTCCTGGG + Intergenic
1057236475 9:93365826-93365848 TGGGGGTGCCTGTGGCTGCATGG - Intergenic
1057817564 9:98306823-98306845 TCTGGGTGTCTGTGTGTGCTTGG - Intronic
1058878115 9:109261701-109261723 TCTGGTTGCCTGTGGGTGGTAGG + Intronic
1060309397 9:122445821-122445843 TCTGGGTCACTCTGTCTGCTAGG - Intergenic
1061257789 9:129462696-129462718 TGTGGTTGCCTGGGGATGCTGGG + Intergenic
1061672162 9:132194797-132194819 CCTGGCTGCCTGGGGCTCCTCGG - Intronic
1062268026 9:135696246-135696268 CCTGGGTCCCTGGGTCTGCTGGG - Intronic
1062564204 9:137156724-137156746 TCCGGGTACGTGTGGCTGGTCGG + Exonic
1203416668 Un_KI270330v1:9-31 CCTGGGTGCCTGGGGCTGACTGG - Intergenic
1185766114 X:2727189-2727211 CCTGGGTGCCTGTGGGTTTTCGG - Intronic
1186561081 X:10614285-10614307 ACTGGGGGCCTGTGGCTCCCTGG + Intronic
1188284786 X:28314424-28314446 TATGTGTGTCTGTGGCTCCTGGG + Intergenic
1188814933 X:34701258-34701280 TTTGGTTGCCTGTGCTTGCTGGG - Intergenic
1189097106 X:38151979-38152001 ACTGGGTGCCTGGGGTTGCAGGG - Intronic
1191108447 X:56787296-56787318 TGTGTGTGCGTGTGTCTGCTTGG - Intergenic
1192795470 X:74421611-74421633 GCGGGGGGACTGTGGCTGCTTGG - Exonic
1193035710 X:76948857-76948879 TGTGTGTGTCTGTGTCTGCTAGG + Intergenic
1194059892 X:89183118-89183140 CTTGTGTGCCTGTGGCTGTTGGG + Intergenic
1194322572 X:92469427-92469449 TTTGGTTGCCTGTGCCTGTTGGG + Intronic
1194777635 X:97984524-97984546 TCTGGGTGTCTCTGGGTTCTGGG + Intergenic
1194962359 X:100250349-100250371 TCAGGGTGCTAGTGGGTGCTGGG - Intergenic
1195312432 X:103644316-103644338 TCTTGGTGCTTGTGGTTGTTTGG - Intergenic
1199111252 X:143937398-143937420 TTTGGTTGCCTGTGCCTGCGTGG - Intergenic
1199175966 X:144787344-144787366 CCTAGGTGGCTGTGGCTGCAGGG + Intergenic
1200009983 X:153113664-153113686 CCAGGGTGCCTGTGACTGCCCGG + Intergenic
1200029617 X:153286258-153286280 CCAGGGTGCCTGTGACTGCCCGG - Intergenic
1200094457 X:153650658-153650680 ACTGGATCCCAGTGGCTGCTTGG + Exonic
1201320927 Y:12697786-12697808 TCTGAGAGCATGAGGCTGCTCGG - Intergenic