ID: 1077523523

View in Genome Browser
Species Human (GRCh38)
Location 11:3050338-3050360
Sequence GCTTTGCTTCTGGGTGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 6, 3: 38, 4: 292}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077523523_1077523528 5 Left 1077523523 11:3050338-3050360 CCACAGGCACCCAGAAGCAAAGC 0: 1
1: 0
2: 6
3: 38
4: 292
Right 1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG 0: 1
1: 0
2: 1
3: 3
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077523523 Original CRISPR GCTTTGCTTCTGGGTGCCTG TGG (reversed) Intronic
900049979 1:588394-588416 ACTTTCCTTCCGGCTGCCTGTGG + Intergenic
900605761 1:3522903-3522925 GCGGGGCTTCTGGGAGCCTGGGG - Intronic
900872396 1:5313270-5313292 GCCGGCCTTCTGGGTGCCTGTGG - Intergenic
901836094 1:11925327-11925349 GCTTTGCTTTTGAGCACCTGGGG + Exonic
902561822 1:17282380-17282402 CCTTTGCTTCTCTGTTCCTGGGG + Intronic
902699285 1:18160773-18160795 GCAGTGATTCTGGGTGGCTGCGG - Intronic
903126615 1:21252590-21252612 CCATTACTTCTGGGGGCCTGAGG - Intronic
903918203 1:26779952-26779974 GCTTCCGTTCTGGGTGCTTGTGG - Exonic
903969365 1:27108969-27108991 GCTCTGCTCCTGGGAGCCAGGGG + Intronic
904127145 1:28249010-28249032 GCTTTGTTTCTGGGAGTCTGTGG + Intergenic
905101804 1:35530786-35530808 GCTTTGATTCTGGATGCATGCGG + Intronic
905284729 1:36871840-36871862 GCTCTGCTCCTGTGTGGCTGTGG + Intronic
905812013 1:40919767-40919789 GCTTTCCTCTTGGGTCCCTGGGG - Intergenic
906827665 1:48998948-48998970 GTTCTGCTTCTGGGTACATGTGG - Intronic
906864317 1:49399875-49399897 GCTTTGGTTGTCTGTGCCTGTGG + Intronic
908492844 1:64663747-64663769 GCTTTGTCTCTGGCTGGCTGAGG - Exonic
910565107 1:88635178-88635200 GCTTTGGTTCTGGATGGTTGTGG + Intergenic
911263929 1:95720742-95720764 TATTTTCTTCTGTGTGCCTGAGG + Intergenic
911412334 1:97525391-97525413 GCTTTGCTTGTGGGAAGCTGAGG - Intronic
911560280 1:99396675-99396697 CCTTTGCTTCTGTGAGTCTGAGG + Intergenic
913093553 1:115496133-115496155 GCTTTGCTACTGGGGGCATTTGG - Intergenic
913317595 1:117565859-117565881 GCCTTGCAGCTGGGAGCCTGCGG - Intergenic
913549717 1:119906105-119906127 GCTTTGATTCCAGGTGCATGCGG + Intergenic
914994846 1:152534478-152534500 CTTTTGCTTCTAGGTGCCTCAGG - Intronic
915889016 1:159753686-159753708 GCATTGCTCCCTGGTGCCTGTGG - Intergenic
917085446 1:171300131-171300153 ACTTTGATTTTGGGTGCATGCGG - Intergenic
917610563 1:176684913-176684935 GCTTGTCTTCTGGATGCCTGCGG + Intronic
918526700 1:185472648-185472670 GCTTTGCTGGTTGGTGCCTGTGG + Intergenic
918857945 1:189782665-189782687 GCTTTGCTTGTAGGTTCCAGAGG - Intergenic
920030800 1:203036382-203036404 GCTATGCTACGGGCTGCCTGGGG + Intronic
922870638 1:228899483-228899505 GCTATGCTTCCTGGTGGCTGAGG + Intergenic
922935587 1:229419909-229419931 GCTTTGCCTCATGGTGCCCGGGG + Intergenic
923176563 1:231472205-231472227 TCTTTGTTTCTGGATGCCTTGGG + Intergenic
923834579 1:237595981-237596003 GTTTTGGTTCTGGGTGGATGCGG - Intronic
923961983 1:239095855-239095877 GCTTTGCATCTGGGCACATGGGG + Intergenic
1063237475 10:4132918-4132940 GCTGTGCTGCTGTCTGCCTGTGG + Intergenic
1064367106 10:14717995-14718017 GTTTTGGTTCTTGGTTCCTGGGG + Intronic
1064762424 10:18635052-18635074 GCTTTCCTTTTGGGAGTCTGGGG + Intronic
1066037430 10:31507999-31508021 GCTTTGATTCTGGGTACATGTGG + Intronic
1067218236 10:44321628-44321650 GATTTGATTCTGGTTGCCTGAGG + Intergenic
1067581959 10:47451791-47451813 CCTGTCCTTCTGTGTGCCTGTGG - Intergenic
1069783685 10:70974444-70974466 CCTGTGTTTCTCGGTGCCTGGGG + Intergenic
1071346694 10:84700295-84700317 TCTGTGCTTCTGGGTTCCTGTGG + Intergenic
1072659688 10:97356172-97356194 TCTTTGCTTCTGGCTGCCTGTGG + Intergenic
1073043532 10:100622921-100622943 CCTGTGCTTTTGGGCGCCTGTGG + Intergenic
1073597598 10:104816720-104816742 GCTCTGCTGCTGTGTGACTGGGG + Intronic
1074976859 10:118588097-118588119 GCTTTTCTTCTGGGCTGCTGTGG + Intergenic
1075329124 10:121559977-121559999 GCTTGGTTTTTGGATGCCTGGGG - Intronic
1075948550 10:126458150-126458172 GATCTTATTCTGGGTGCCTGGGG - Intronic
1076507344 10:130986926-130986948 AGTGTGATTCTGGGTGCCTGGGG + Intergenic
1077410644 11:2402425-2402447 TCTTGGCTGCTGGGTGCCAGTGG - Exonic
1077523523 11:3050338-3050360 GCTTTGCTTCTGGGTGCCTGTGG - Intronic
1077637998 11:3856210-3856232 GCTTTGCCTCTGGGATCCCGAGG + Exonic
1077933115 11:6753984-6754006 GCATGTCTTCTGGGTGCCTGGGG + Intergenic
1078296782 11:10078984-10079006 GCTTTGCTTATGGGTGCATTTGG - Intronic
1079540111 11:21563115-21563137 ACTTTTCATCTGGGTTCCTGTGG - Intronic
1080864071 11:36178032-36178054 GCTTTCCTGCTGTGTTCCTGTGG + Intronic
1081579982 11:44345571-44345593 GCTTTTCTCCTGGGTGGCTTTGG - Intergenic
1083626133 11:64073015-64073037 GCTCTGCCTCTGGCTGCCTGTGG - Intronic
1084357293 11:68648407-68648429 CCTCTGCTTCTGGGTCCCTGGGG + Intergenic
1084574690 11:69981591-69981613 GCTTTGCTGCTGGGAGCCCCTGG + Intergenic
1086507604 11:87522230-87522252 CCTTAGCTTCTGGGATCCTGAGG - Intergenic
1086956000 11:92934965-92934987 GCTTTTCTCCTGAGTGACTGGGG - Intergenic
1087018433 11:93577775-93577797 GCTTTGTTTTTGGGAGGCTGAGG + Intergenic
1087836199 11:102877769-102877791 GATTTGCCTCTGGATTCCTGGGG + Intergenic
1087960219 11:104339161-104339183 GCTGGGCTTCTGGGTCGCTGGGG + Intergenic
1089135129 11:116242819-116242841 GCATTGCTTTTGTGTGGCTGTGG - Intergenic
1090035090 11:123242472-123242494 GCTGTTCTTCAGGGTGGCTGGGG + Intergenic
1090219631 11:125007821-125007843 GCTTGTCATCCGGGTGCCTGGGG - Intronic
1090419024 11:126561330-126561352 CCTCAGCTTCTGGGTGGCTGAGG - Intronic
1091592361 12:1851514-1851536 GATTTCCTTTTGGGTTCCTGTGG + Intronic
1092028705 12:5265255-5265277 ACATTGCTGCTGGGAGCCTGGGG - Intergenic
1092242257 12:6842550-6842572 GCTTTTTAACTGGGTGCCTGGGG - Intronic
1093337351 12:17921910-17921932 GTTTTGTTTTAGGGTGCCTGTGG - Intergenic
1098034432 12:66287782-66287804 GCTTTCCTTCTGGGTGCTCCAGG - Intergenic
1103744909 12:123115956-123115978 GCTGTGCTCCTGGATGCCTCTGG - Intronic
1104804698 12:131578019-131578041 GCCTGGCTTCTGGGTCCCTGGGG + Intergenic
1104844918 12:131841853-131841875 GCTCTGCTCAGGGGTGCCTGGGG - Intronic
1105476286 13:20730453-20730475 TCTTTATTTCTGGGTACCTGTGG - Intronic
1105612144 13:21977880-21977902 GCTTTTCTCCTGGGAGGCTGAGG + Intergenic
1110062112 13:71055697-71055719 GTTTTGATTATGGGTGCATGTGG + Intergenic
1111649829 13:91075386-91075408 GATTTGTTCCAGGGTGCCTGTGG - Intergenic
1112546791 13:100379134-100379156 GCTTTGATTCTGGGTGCATGTGG + Intronic
1113052937 13:106234868-106234890 GCCTTGCTTCTGTGTGACGGAGG + Intergenic
1113502857 13:110792198-110792220 GCTCCGTTTCTGGCTGCCTGTGG + Intergenic
1114081061 14:19201596-19201618 ACTTTGCTACTGGGCTCCTGCGG + Intergenic
1116021211 14:39463500-39463522 GCTTTGCTTGCCTGTGCCTGTGG + Intergenic
1117744933 14:58860177-58860199 GCATTCCTCCTGGGGGCCTGAGG - Intergenic
1117884639 14:60347574-60347596 GGTTTGCTTCTTGATTCCTGAGG - Intergenic
1118520265 14:66575678-66575700 GCCTGGATCCTGGGTGCCTGGGG + Intronic
1118972278 14:70646849-70646871 GCTTTGCTTTTCAGTGCTTGTGG + Intronic
1119493308 14:75056539-75056561 GCTTTGTTTTTGGGAGGCTGAGG - Intronic
1119703896 14:76772413-76772435 GCTTTGCTTTTGTTGGCCTGTGG + Intronic
1120131150 14:80808795-80808817 GCTTTTATTCTGGGTGCATGTGG - Intronic
1120715544 14:87837303-87837325 TCTTTGCTTCTTGCTGCCTTTGG - Intergenic
1121563074 14:94888405-94888427 GCTGTCCTCCTGGGAGCCTGTGG - Intergenic
1121999425 14:98634629-98634651 GGTTTGCTTCTTTGTCCCTGGGG + Intergenic
1122378593 14:101285917-101285939 CTCTTGCTTCTGGGTGGCTGGGG + Intergenic
1123818876 15:24006262-24006284 GCATTGCTTCTGGGTCTATGAGG - Intergenic
1123837953 15:24214937-24214959 GCTTTACTTCTGGGTCGGTGAGG - Intergenic
1123847487 15:24317234-24317256 GCTTTACTTCTGGGTCTGTGAGG - Intergenic
1124595243 15:31086548-31086570 CCCTGGCTTCTGGGTGCCTGTGG + Intronic
1124608599 15:31192408-31192430 TCTTTGCTCCTGTGTGTCTGGGG + Intergenic
1125834584 15:42737842-42737864 GATTAGCTTCTGGGAGCTTGAGG + Intergenic
1128882206 15:71254269-71254291 GCTCTGCTTCTGTGTCACTGTGG + Intronic
1130276240 15:82477712-82477734 TCTCTGCTTCTGGGAGCCAGTGG - Intergenic
1130403753 15:83580229-83580251 GCTGTGCTTCGGGATGGCTGGGG + Intronic
1132089642 15:98937372-98937394 GCTCTGCGGCTGGCTGCCTGTGG + Intronic
1133327187 16:4948945-4948967 GCTTTGGGTGTTGGTGCCTGTGG + Intronic
1133777999 16:8913007-8913029 TGTTTGATTCTGGCTGCCTGAGG - Intronic
1134531728 16:14989250-14989272 GCTTTGCTTTTGGGCACCTGGGG + Intronic
1136627162 16:31468608-31468630 GGTTTGCTTCTGGGCAGCTGAGG + Intergenic
1137657097 16:50169710-50169732 GCCTTGCTTCTCTTTGCCTGGGG - Intronic
1137661329 16:50209473-50209495 GCTATGCCTCTGGGTACCTCAGG - Intronic
1137876074 16:51997767-51997789 GCTGGGCTTCTGGGTAGCTGGGG + Intergenic
1138016081 16:53430001-53430023 GCATTGCTTCTGGGAGCTTAGGG + Intergenic
1139735711 16:68986341-68986363 GCTTTGCCTCAGGATTCCTGGGG - Intronic
1141134714 16:81457869-81457891 GATTTCCTTCTGGGGGCCTGGGG - Intronic
1142339758 16:89513716-89513738 GCTTTGCTTTTGGATCCTTGAGG + Intronic
1142355541 16:89599847-89599869 TCTGTGCTGCTGGGTGTCTGGGG + Intergenic
1142472657 17:172021-172043 GCTGGGGTTGTGGGTGCCTGTGG - Intronic
1142869007 17:2808581-2808603 GCTCGGCTCCTGGGTGCCTTTGG + Intronic
1143073255 17:4316186-4316208 CCTTTGTGTCTGGGTGACTGTGG + Intronic
1143616824 17:8056541-8056563 GCTTTGCCTCTGGGAACATGCGG - Intergenic
1144437970 17:15258366-15258388 CCTTTCCCTCTGGGTGCCTTGGG + Intronic
1144652816 17:17018029-17018051 GCCGTGCTTCTGGCTGCCTGGGG + Intergenic
1145144910 17:20472313-20472335 ACTTTGCCTCTGTGTGACTGTGG - Intergenic
1145912547 17:28551088-28551110 CCTGTGCTCCTGGGTCCCTGGGG - Intronic
1146578465 17:34014611-34014633 GCTTGGTTTCTGCCTGCCTGTGG - Intronic
1147970018 17:44214249-44214271 GCTCTGCTTCTGGTTTTCTGTGG - Intronic
1148037301 17:44676533-44676555 CCTTTGCAGCTGGGTGCCGGTGG + Intronic
1148601588 17:48898509-48898531 GCTTTGCTTCTGGTTGTCACTGG - Intergenic
1151538320 17:74750825-74750847 GTTATGCTGCTGGGTGCCAGAGG + Intronic
1154231520 18:12559713-12559735 GCTTTGGTTCCCTGTGCCTGTGG - Intronic
1154499362 18:14987525-14987547 ACTTTGCTACTGGGCTCCTGTGG - Intergenic
1154945245 18:21156639-21156661 GCTTTGATTCTTGGTGGGTGCGG + Intergenic
1155368626 18:25074790-25074812 GCTTTACTTCTAGGTCTCTGTGG + Intronic
1157451120 18:47789954-47789976 GCTTTGCTCATGAGAGCCTGTGG - Intergenic
1158605479 18:58891970-58891992 GCCTTGCTTATGGGTGAGTGGGG - Intronic
1161760946 19:6172422-6172444 GCCTTGCTTCTGAGTGCTTTTGG + Intronic
1161768953 19:6221152-6221174 GCTTTGCCTCTGGGTTGCTGAGG - Intronic
1163595685 19:18219909-18219931 GCTTGGCCCCTGGGTGCCTGGGG + Intronic
1163743228 19:19029576-19029598 GGTGTGGTTGTGGGTGCCTGTGG - Intronic
1166176976 19:41081253-41081275 GCTTTGATTCTGGGTGCCTATGG + Intergenic
1166217678 19:41346426-41346448 GCTTGGCTTCTTGGAGTCTGGGG - Intronic
926031876 2:9598120-9598142 GGTTTGCTTCTGGCTGGGTGCGG - Intronic
926809086 2:16740600-16740622 GCTTTGCTTCTGACTACTTGGGG - Intergenic
927135910 2:20096462-20096484 GCTTTGTGTCTGGCAGCCTGAGG - Intergenic
927353808 2:22151072-22151094 GCTTTGATTTTGGGTGCCCATGG + Intergenic
927747958 2:25640012-25640034 ACTTTGCTTCATGATGCCTGAGG - Intronic
928073619 2:28242359-28242381 CCTTTCCTTCTGGCTGCCTGTGG + Intronic
928798289 2:35053195-35053217 GCTTTGATTTTGGTTGCCTATGG + Intergenic
929463935 2:42128060-42128082 GTTTTGCATCTAGGAGCCTGGGG - Intergenic
929484217 2:42340188-42340210 GCTTGGCTTCTGGGTGAGTGGGG - Intronic
930994502 2:57700098-57700120 GCATTCCTTCTGGGTGGCAGAGG - Intergenic
932262275 2:70336891-70336913 GCTTTGCTGGTGGGTGAGTGAGG + Intergenic
933327932 2:80862834-80862856 GCTTTATTTCTGGGTGCTTTTGG + Intergenic
934554445 2:95279947-95279969 CCTTGGCTTCTGGGTGGCTGGGG - Exonic
934676780 2:96254892-96254914 GCTTTCCTTCTGGATGTCTTTGG - Exonic
935397201 2:102620695-102620717 CTTTTGCTTCGGGGTGGCTGAGG + Intronic
937245184 2:120487977-120487999 GAGATGCTTCTGGGAGCCTGAGG - Intergenic
937284187 2:120739543-120739565 GCCTTGCTTCTTGGAGGCTGTGG + Intronic
937680819 2:124642488-124642510 GCTTAGGTTCTGGTAGCCTGAGG + Intronic
937885642 2:126898178-126898200 GCCATGCTTCTGAGTGCCTTAGG - Intergenic
938023667 2:127926384-127926406 GCTTGGCTTCTGGGGGCCTCAGG + Intergenic
939232895 2:139454055-139454077 GCTTTACTTCTTGGTGTGTGTGG + Intergenic
939376458 2:141375084-141375106 GCTTTGATTTTGGGTGCCTGTGG + Intronic
939808424 2:146803768-146803790 GCTTGGCTTCTGGGGGCCTCAGG + Intergenic
940893204 2:159055314-159055336 GCATGGCTACTGGGTCCCTGAGG + Intronic
942491028 2:176490163-176490185 ACTCTGCAGCTGGGTGCCTGTGG - Intergenic
944079075 2:195765340-195765362 GCTTTGTTTGTCTGTGCCTGTGG - Intronic
945217810 2:207453665-207453687 GCTTTGGTTGTGTGTGCTTGTGG - Intergenic
948620489 2:239231605-239231627 GGTTTGCTCCCGGATGCCTGAGG + Intronic
948795815 2:240401614-240401636 GCTGTGCTTCAGTGTCCCTGAGG - Intergenic
1169412430 20:5383052-5383074 GCATGGCCTCTGGGGGCCTGAGG + Intergenic
1169412447 20:5383121-5383143 GCACTCCTTCTGGGGGCCTGAGG + Intergenic
1169873502 20:10271916-10271938 ATTTTGCTGCTGGGTTCCTGGGG - Intronic
1170747043 20:19109088-19109110 GGTTTACTACTGTGTGCCTGTGG + Intergenic
1171141388 20:22746830-22746852 CCTCTGCTTCTTGATGCCTGGGG + Intergenic
1171173457 20:23034986-23035008 GCTTTGCTACAGGGGGTCTGCGG - Intergenic
1172226307 20:33307278-33307300 GCCATGCTTCTGAGTGCTTGAGG + Intronic
1172430894 20:34890673-34890695 GCTTTGCTTTGGGTTGCCTAAGG + Intronic
1173127354 20:40351423-40351445 GCTTTGGTTGCGTGTGCCTGTGG - Intergenic
1173997831 20:47353001-47353023 GCTTTGCCTCTGGTTGACTCTGG - Intronic
1174108141 20:48177614-48177636 GCTTTTGTTCTGGGTTCCTAGGG - Intergenic
1175491269 20:59382653-59382675 GCTGTGCTTGTGTCTGCCTGTGG + Intergenic
1175493179 20:59393052-59393074 TCTTTGTGTCTGGGTGGCTGAGG - Intergenic
1175668007 20:60876848-60876870 ACTCTGCTTCTGTGAGCCTGGGG + Intergenic
1175863748 20:62163693-62163715 GCTTCTCTTCGGGGAGCCTGGGG + Intronic
1175952791 20:62592342-62592364 GCTGTGCTCCAGGCTGCCTGTGG - Intergenic
1179707280 21:43188936-43188958 GCCTTGCCTCTGCGTCCCTGTGG + Intergenic
1180499712 22:15921089-15921111 ACTTTGCTACTGGGCTCCTGCGG - Intergenic
1181164844 22:20977712-20977734 GCTTTGCCTCAGGAAGCCTGTGG - Exonic
1181527986 22:23501053-23501075 GCCTTGGTTCTGGGAGCCTGTGG - Intergenic
1181887722 22:26034831-26034853 GCTTTGCTATTGAGTGCCTTTGG - Intergenic
1182090501 22:27591365-27591387 GCTTTCCTCCTGGGACCCTGTGG - Intergenic
1182589410 22:31367284-31367306 GCTGTGGTTCTGTGTGCCTGTGG - Intergenic
1182862088 22:33568933-33568955 GCTTTGCATCTTGCTGGCTGTGG - Intronic
1183759011 22:39798954-39798976 GCATTCCCTCTGGGGGCCTGAGG - Intronic
1185271360 22:49930634-49930656 GCTGTGGTTCTGGGCCCCTGTGG - Intergenic
950301125 3:11880030-11880052 GCTGTGCTTGTGCATGCCTGTGG - Intergenic
950357958 3:12427643-12427665 ACTTAGTTTCTGTGTGCCTGTGG - Intronic
951619568 3:24586589-24586611 GCTTTATATCTGGGTGCCAGTGG + Intergenic
952269130 3:31815257-31815279 TCTCTGCTCCTGGGTGTCTGGGG - Intronic
952715526 3:36476202-36476224 TCTTTACCTCTGGGTCCCTGTGG - Intronic
952973694 3:38674887-38674909 GCCTTGGTTCTTGGTGGCTGTGG + Intergenic
953844559 3:46417073-46417095 GTTTTGCTTATGGGTACCTGCGG - Intergenic
954085473 3:48240892-48240914 ATTTTGCTTATGGGTACCTGTGG + Intergenic
954479845 3:50788734-50788756 GACTTCCTTCTGAGTGCCTGAGG + Intronic
955215198 3:56979513-56979535 GCCTTGTCTCTGGCTGCCTGTGG - Intronic
956011081 3:64832315-64832337 GCCTTGGTTCTGGATGTCTGTGG + Intergenic
956303936 3:67804040-67804062 ACTTTGCTTATGGGTGCATTTGG + Intergenic
956460788 3:69470024-69470046 GTTTTGCATCTGGGTGTCTTGGG - Intronic
956870503 3:73412589-73412611 GCTTTGGGTCTGTTTGCCTGGGG + Intronic
959547091 3:107609304-107609326 GTTTTGCATCTGGGTTCCTTAGG + Intronic
960861174 3:122154763-122154785 GCTTTGATTGTGGGTACATGTGG - Intergenic
961418078 3:126776119-126776141 GCTGTGCTTCTGGTTGTCTTGGG + Intronic
963611974 3:147481032-147481054 GCTTTGCTTCTGGCACACTGAGG - Intronic
966893106 3:184422245-184422267 GGTTTGGTGGTGGGTGCCTGTGG - Intronic
967245004 3:187477698-187477720 GCTTTGCTTCTGGGCACAGGAGG + Intergenic
969334927 4:6502212-6502234 GCTATGCTTCTTGGTCACTGGGG + Intronic
972971712 4:44583856-44583878 GCTTTGTTTCTGTGTGCTTTCGG - Intergenic
974070800 4:57121757-57121779 GCTTTATTTCTGGGTGTCTATGG + Intergenic
976795695 4:88930398-88930420 GCTTTGATTTTGGGCACCTGAGG + Intronic
977047342 4:92083999-92084021 GCTTTTCTTCTGGGTTTTTGTGG - Intergenic
977514786 4:98007387-98007409 GCTTTGCTTCTGGGTATGTTTGG - Intronic
978686374 4:111449781-111449803 GCTTTTCTTCTGGCTGGGTGGGG + Intergenic
978908700 4:114040451-114040473 GCTTTGCTACTGAGTGACTTTGG - Intergenic
980032514 4:127846453-127846475 GTTTTGGTTCTGGGTGCTTTTGG - Intergenic
981672711 4:147305658-147305680 GCTTCACTTTTGGGTGCCTGAGG + Intergenic
981998660 4:151002029-151002051 GCTTTGATTCTGGGTCTGTGTGG - Intronic
982077906 4:151757227-151757249 GATTTGCTGCTGGGTCCCTCTGG - Intronic
984233497 4:177129539-177129561 GCTTTGATTTTGGGTGTCTGTGG + Intergenic
985371148 4:189285795-189285817 GCTTTCCTGCTGGGTGCTGGGGG + Intergenic
985424106 4:189811859-189811881 GCCCTGGTTCTGGTTGCCTGGGG - Intergenic
986363269 5:7002836-7002858 ACTTTGCTTCTGGGTGGAGGAGG + Intergenic
988143273 5:27269950-27269972 GTTTTGCTTCTGAGTGGTTGTGG - Intergenic
988746245 5:34141857-34141879 GGTTGGCTTCTGGGTGCCCTAGG - Intergenic
988832825 5:35004146-35004168 GCTTTGCTAATGGCTGCCTTGGG + Intronic
990644151 5:57824846-57824868 TCTATGTATCTGGGTGCCTGTGG + Intergenic
990656797 5:57965862-57965884 GCTTTGATTTTGGGTGCCTATGG - Intergenic
991164823 5:63553156-63553178 GATTTTCTTCTGGCTGCCTAAGG - Intergenic
991447689 5:66717629-66717651 GCTTTGCTACTGTTTCCCTGGGG + Intronic
995020820 5:107365539-107365561 GCTCTGCTTCTAATTGCCTGAGG + Intergenic
995586948 5:113657821-113657843 GCTTTGCTTTTTGGTAACTGGGG + Intergenic
997020987 5:130001459-130001481 GCTTTGCTCCTTTGTGCCTGTGG + Intronic
997416121 5:133730071-133730093 ACTTTGATTGTGGGAGCCTGAGG + Intergenic
999277506 5:150341205-150341227 GCTAAGCTTGTGGCTGCCTGTGG + Intergenic
999398215 5:151244342-151244364 GCTCTGCTTCTTGGTGGATGTGG - Intronic
999528671 5:152437111-152437133 GCTGTGGTGGTGGGTGCCTGTGG - Intergenic
1000238512 5:159386920-159386942 GCTTTGATTTTAGATGCCTGTGG + Intergenic
1001089714 5:168728234-168728256 GGTTTGATTTTGAGTGCCTGTGG - Intronic
1001289159 5:170444225-170444247 GCGTTCCTTCTGGGGTCCTGGGG + Intronic
1002076783 5:176713055-176713077 CCTCTGCTAATGGGTGCCTGTGG + Intergenic
1002629318 5:180559675-180559697 TCTTTGCTTCTGCCTGCCTATGG + Intronic
1002953107 6:1835222-1835244 GCTCTTCTTCTGGCTGCCTTAGG - Intronic
1003420915 6:5957872-5957894 GCTTTGCTTGTGGATGCCTCAGG - Intergenic
1004704688 6:18113463-18113485 GCTTTGGTTGCTGGTGCCTGTGG - Intergenic
1005158539 6:22835415-22835437 ACTTTGACTTTGGGTGCCTGTGG - Intergenic
1006480026 6:34284947-34284969 GCCTTGCTTCTTGGAGCCTCTGG - Exonic
1007106699 6:39288338-39288360 GCTTGGCATCTGTGTGGCTGCGG - Intergenic
1007187920 6:39988136-39988158 GCTTTGCTTCTGGGGACTTATGG - Intergenic
1007533664 6:42564876-42564898 GTTTGCCTTCTTGGTGCCTGGGG - Intronic
1008771809 6:54988145-54988167 GCTTTGCCTCTCAGTGGCTGTGG + Intergenic
1010673814 6:78718418-78718440 GCTTTGCTACTTGGTGCCTCAGG + Intergenic
1010676076 6:78745304-78745326 GCTTTGATTCTGGGTGCATATGG + Intergenic
1012300000 6:97574530-97574552 GCATGGCCTCTGGGTGACTGTGG + Intergenic
1013914041 6:115312664-115312686 GCTTAGGTTCTGGGTGGCTGGGG + Intergenic
1014707788 6:124769262-124769284 GCTTTGGTTCTGACTGCCTAGGG - Intronic
1016900706 6:149097830-149097852 ACTTTGATTTTGGTTGCCTGTGG - Intergenic
1016952498 6:149593916-149593938 CCATTGCCTCTGGGTGCCAGCGG - Intergenic
1018854062 6:167662960-167662982 GCTCTGCCTTTGGGAGCCTGGGG + Intergenic
1019520984 7:1460346-1460368 GCTTTTCTTCTGGGGGCCTGTGG + Intergenic
1019783410 7:2958310-2958332 GATTTGGTTGTGTGTGCCTGTGG + Intronic
1021340362 7:19456982-19457004 GCTTTGATTTTGGGTCCCTAGGG + Intergenic
1022949032 7:35317899-35317921 ACTTTGCTTCAGGAAGCCTGGGG - Intergenic
1023316939 7:38947747-38947769 GCATTCCTTCTGGGTGGCAGAGG + Intergenic
1024508821 7:50186372-50186394 CCTTGGGTGCTGGGTGCCTGAGG + Intergenic
1024802620 7:53098705-53098727 GTTTTGTTTATGGGTTCCTGGGG + Intergenic
1026573097 7:71548987-71549009 GCTTTGCTTCTGAGCCTCTGGGG + Intronic
1027170099 7:75865815-75865837 GGTGTGGTTGTGGGTGCCTGTGG + Intronic
1029513629 7:101012554-101012576 GCCTGGCTTCTGGGTTCCTGTGG - Intronic
1030812634 7:113993198-113993220 GCTTTGGTTCTCTGTGCTTGGGG - Intronic
1031700774 7:124922948-124922970 GCTTTGATTTTGGGTGCCTGTGG - Intronic
1031989733 7:128189742-128189764 GCCTGGCCTCTGGGTGGCTGGGG + Intergenic
1032288197 7:130559658-130559680 GCTTTGATTTTGAGTGCCTGTGG - Intronic
1032841521 7:135717737-135717759 GCATTGCTTCTGGGTGTTTCTGG + Intronic
1033194904 7:139319428-139319450 TCTTTCCTTTTGGCTGCCTGAGG + Intergenic
1034734457 7:153415456-153415478 GCTTTATTTCTGGGTCTCTGTGG + Intergenic
1035262444 7:157670596-157670618 GCTTTGCTGCGGTGTGACTGGGG - Intronic
1035611390 8:967364-967386 GCTTAGGCTTTGGGTGCCTGTGG + Intergenic
1036401622 8:8413828-8413850 GAGTCGATTCTGGGTGCCTGGGG + Intergenic
1037941849 8:22957513-22957535 GCGTGGCTTCTTTGTGCCTGTGG - Intronic
1038997831 8:32945490-32945512 GCATTCCTTCTGGAAGCCTGAGG - Intergenic
1039906380 8:41789527-41789549 GCTGTGCTGCTGGGCCCCTGCGG + Intronic
1040290886 8:46123560-46123582 TTTTTGCTTGTGGGGGCCTGTGG + Intergenic
1040292306 8:46131776-46131798 GCTTTGGAGCAGGGTGCCTGTGG - Intergenic
1040292406 8:46132211-46132233 GCTTTGGAGCAGGGTGCCTGTGG - Intergenic
1040310051 8:46232179-46232201 GCTTTGAAGCAGGGTGCCTGTGG + Intergenic
1040487033 8:47883459-47883481 CCTTTGCTTCTGGGCTCCTCTGG + Intronic
1045010050 8:97951042-97951064 GCTTTGCGTGTGTGTGCGTGCGG - Intronic
1046507861 8:115159357-115159379 GCTGGGCTTCTGGGTCCATGGGG - Intergenic
1046749371 8:117910872-117910894 GCTTTGCTGCTGGGTGCCACTGG + Intronic
1046792759 8:118339655-118339677 GCTTTTCTGATGGGTCCCTGAGG + Intronic
1046929741 8:119830036-119830058 GCTGTGGTGGTGGGTGCCTGTGG - Intronic
1047682113 8:127264781-127264803 ACTTAGCTACTGGGTGCCTTTGG + Intergenic
1047773812 8:128052192-128052214 GCCTAGATTCTGGGTCCCTGGGG + Intergenic
1048380310 8:133859807-133859829 GATTGGCTTCTGGGTGGCAGAGG + Intergenic
1049091237 8:140515425-140515447 GCTTTCCCTCTGGCTGTCTGTGG - Exonic
1049584297 8:143425819-143425841 GCTCTGGTTCTGGGTGACGGTGG + Intronic
1049584649 8:143427287-143427309 CCTTTGCTTTTGGGTCTCTGCGG - Intronic
1050048768 9:1576132-1576154 GCTTGGATTCTGGGTCCATGGGG + Intergenic
1051137196 9:13935568-13935590 GCTTTGCTTTTGTTTTCCTGGGG - Intergenic
1051414469 9:16824594-16824616 GCATTGGTTCGAGGTGCCTGGGG - Intronic
1057067253 9:92066838-92066860 GGTTTGGTGGTGGGTGCCTGTGG + Intronic
1057091558 9:92262583-92262605 GCTTTGATCCTGGGCACCTGTGG + Intronic
1057329854 9:94103788-94103810 GCATTGCTCCTGGGGGACTGGGG + Intronic
1058668726 9:107342883-107342905 GCTTTGCCACTGGGTGCCACTGG + Intergenic
1059284281 9:113159531-113159553 GATTTCCTCCTGGGAGCCTGTGG + Intronic
1059316212 9:113427800-113427822 GCTTTGTTTATGGGTACATGAGG + Intronic
1060118392 9:120964875-120964897 GCTTTGGTTTTGGGTGGCAGAGG + Intronic
1060198205 9:121636643-121636665 GCTTGGCCTGTGGGTGCATGGGG + Intronic
1060875581 9:127081424-127081446 GCCTTGCTGTTGGGTTCCTGTGG + Intronic
1061256265 9:129455436-129455458 GCCTCGGTTCTGGGAGCCTGTGG + Intergenic
1062164743 9:135101975-135101997 TCTGTGCTTATGGGTGTCTGGGG - Intronic
1186728586 X:12383570-12383592 TCTGTGCTTCTGGGTGGCAGTGG + Intronic
1187409596 X:19038740-19038762 GCCTGGCTTCTGGGTGCCCTGGG - Intronic
1191146310 X:57169085-57169107 GCTTTGCTTCTGTGCATCTGTGG + Intergenic
1192089021 X:68132976-68132998 GCTTGGCGTCCGGGGGCCTGAGG - Intronic
1192162462 X:68798753-68798775 TCTTGACTTCTGTGTGCCTGAGG - Intergenic
1192959929 X:76118242-76118264 GCTTTGGTTGTGTGTGCTTGTGG - Intergenic
1193292837 X:79796722-79796744 GCTGTGCTTGTTGCTGCCTGTGG - Intergenic
1193486978 X:82097410-82097432 GCTTTGGTTGTCTGTGCCTGGGG + Intergenic
1195146994 X:102027690-102027712 GCTTTGATTCTGTGTGGGTGTGG - Intergenic
1195698950 X:107687625-107687647 GCTTGTGTTCTGAGTGCCTGAGG + Intergenic
1199135686 X:144248732-144248754 ACTTTGCTTGTCTGTGCCTGTGG - Intergenic
1199304475 X:146251381-146251403 GCTTTGATTGTCTGTGCCTGTGG - Intergenic