ID: 1077523526

View in Genome Browser
Species Human (GRCh38)
Location 11:3050347-3050369
Sequence GTGCCCAGAGCTTTGCTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 208}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077523526_1077523528 -4 Left 1077523526 11:3050347-3050369 CCCAGAAGCAAAGCTCTGGGCAC 0: 1
1: 0
2: 1
3: 17
4: 208
Right 1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG 0: 1
1: 0
2: 1
3: 3
4: 87
1077523526_1077523533 26 Left 1077523526 11:3050347-3050369 CCCAGAAGCAAAGCTCTGGGCAC 0: 1
1: 0
2: 1
3: 17
4: 208
Right 1077523533 11:3050396-3050418 CCCCTTTACAAGTTATCCTTAGG 0: 1
1: 0
2: 0
3: 6
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077523526 Original CRISPR GTGCCCAGAGCTTTGCTTCT GGG (reversed) Intronic
900550327 1:3251331-3251353 GTACCCAGAGCTGTGCCTCACGG - Intronic
901037553 1:6345363-6345385 GGGCCCAGAGCTGTTCTTTTAGG - Intronic
901630631 1:10646563-10646585 GTGCCCAGAGCATTGCATGCTGG + Intronic
902532402 1:17098889-17098911 CTGCCCAGAGCATTGCCTCTTGG + Intronic
903857563 1:26345855-26345877 CTGCCCAGACCTGTGCTCCTTGG + Exonic
903972906 1:27130790-27130812 GAGGGCAGAGCTTGGCTTCTGGG - Intronic
906265356 1:44424761-44424783 GTGCCCAGACCTCCCCTTCTTGG + Intronic
908999765 1:70204795-70204817 GTACCCAGATTTGTGCTTCTTGG + Intronic
910996727 1:93113085-93113107 GCGCCCAGCTGTTTGCTTCTTGG - Intronic
912556005 1:110516399-110516421 CTGCCCAGAGGTTTGCTGCCTGG + Intergenic
915055962 1:153130867-153130889 ATGGCCAGAAGTTTGCTTCTAGG - Intergenic
915111024 1:153564760-153564782 GGGGGCAGAGCTTTGCTGCTTGG + Intronic
917291655 1:173477398-173477420 ATGCCCGGAGGTCTGCTTCTCGG + Exonic
918912903 1:190596458-190596480 GTTCCTGGAGATTTGCTTCTTGG - Intergenic
919956003 1:202416635-202416657 GTGTCCAGAGCATGACTTCTAGG - Intronic
920125504 1:203691048-203691070 TTGCCTAGAGCTGGGCTTCTGGG + Intronic
921303717 1:213774409-213774431 TTTCCCATAGCTTTGCTTTTAGG - Intergenic
922868559 1:228881753-228881775 GTCACCAGAGCTCTGCTTTTGGG - Intergenic
923095261 1:230770467-230770489 GTGCCCAGATATTTGCTTTAAGG - Intronic
923377795 1:233382398-233382420 GTGGACAGTGCTGTGCTTCTTGG - Exonic
924073631 1:240309430-240309452 GTGCCCTGAGGTTTGTTTCCTGG - Intronic
924430204 1:243990069-243990091 CTGCCCAGGGCTATGCTTCCTGG + Intergenic
1063385151 10:5611812-5611834 GTGACCAGAGTTTTTATTCTTGG + Intergenic
1063461947 10:6220619-6220641 GTGGCCTGAGCTGTGGTTCTCGG + Intronic
1065932045 10:30488662-30488684 GTCCCCAGAGCTTCTCTTCCTGG + Intergenic
1067054498 10:43043019-43043041 TGGCACAGAGCTTTGCTTCTGGG - Intergenic
1070327827 10:75399764-75399786 GAGCCCAGAGCCTTGCCTCCCGG + Exonic
1070721421 10:78759909-78759931 CTCCCCAGAGCTTGGCATCTGGG + Intergenic
1070771897 10:79087424-79087446 CTGCCCAGAGCATGGCTTATGGG + Intronic
1071721645 10:88152631-88152653 TTGACCAGAACTTTGCTCCTGGG - Intergenic
1072523727 10:96253409-96253431 GTGCCGAATGCCTTGCTTCTGGG + Intronic
1074416294 10:113269815-113269837 ATGCCCAGAGCTTTGCACCATGG + Intergenic
1074550588 10:114438666-114438688 GTTGCCAGAGCACTGCTTCTGGG - Intronic
1075074618 10:119342602-119342624 CGGTGCAGAGCTTTGCTTCTTGG + Intronic
1076431016 10:130402398-130402420 GTGGCCAGAGCTCTGCAGCTGGG + Intergenic
1076586725 10:131553777-131553799 ATCCCCAGAGCTGTGATTCTCGG - Intergenic
1077523526 11:3050347-3050369 GTGCCCAGAGCTTTGCTTCTGGG - Intronic
1080151130 11:29053385-29053407 CTGGCCAGTGCTTGGCTTCTAGG + Intergenic
1080659043 11:34281067-34281089 ATGCCTAGAACTTTGCTGCTTGG - Intronic
1081476370 11:43436345-43436367 TTGACCTGAGCTGTGCTTCTGGG + Intronic
1082001155 11:47394414-47394436 GTCCCCAAAGCTTTGGCTCTTGG + Intergenic
1083909336 11:65696884-65696906 GTGTCCAGAACTAGGCTTCTGGG - Intergenic
1084623258 11:70288405-70288427 ATTCCCAGAGCTCTCCTTCTTGG + Intronic
1085394890 11:76202256-76202278 ATGCCCACATCTGTGCTTCTGGG + Intronic
1086784691 11:90953521-90953543 ATGCTCAGAGCTTTGCCTTTTGG + Intergenic
1089303039 11:117509967-117509989 GTGGCCAGAGCAGGGCTTCTGGG - Intronic
1089314219 11:117579988-117580010 GTCATCAGAGCTTTGCTTCCTGG + Intronic
1090405512 11:126473748-126473770 GGCCACAGAGCTCTGCTTCTGGG - Intronic
1090830821 11:130419789-130419811 GCGCTCAGAACTTTGCTTCTGGG - Intronic
1091260712 11:134231940-134231962 CCGCCCTGAGCTTTGCTGCTTGG - Intronic
1091761599 12:3091064-3091086 CTGCCAAGAGCTTGTCTTCTTGG + Intronic
1093124090 12:15307423-15307445 GAGCCCTGAGCTGTGCTCCTGGG + Intronic
1096717965 12:53502228-53502250 GTCCCCATGGCTTTGTTTCTTGG + Intronic
1096822635 12:54249011-54249033 GTGCACAGAGTTTTGTTCCTAGG - Intronic
1097288187 12:57893599-57893621 GAGCCTAGAGCCTTGGTTCTCGG - Intergenic
1101835069 12:108289230-108289252 GTGCCCAGAGCCTTCTCTCTGGG - Exonic
1102454143 12:113061125-113061147 GTGACCAGAGCTGAACTTCTGGG - Intronic
1103283916 12:119784507-119784529 GTTTCCAGAGCGTTGCCTCTGGG + Intronic
1103322602 12:120100706-120100728 CTGCCCACAGCTTTGCTTCCAGG + Intronic
1103850143 12:123927805-123927827 GTGCCCAGGGCTTGCCTCCTGGG - Exonic
1104944217 12:132408451-132408473 CTGCCCAGATGTTTGCTTCCAGG + Intergenic
1108709313 13:53017250-53017272 GGGCCCTAACCTTTGCTTCTGGG + Intergenic
1112502279 13:99952372-99952394 GGGCCCACAGCTCTGTTTCTAGG + Intergenic
1113062004 13:106331915-106331937 GTGCCCAGAAAGTTGCTTTTTGG - Intergenic
1113495972 13:110729594-110729616 GTTTCCAGATCTTTGTTTCTAGG - Intergenic
1114591443 14:23868499-23868521 CTTCCCAGAGATTTGTTTCTAGG - Intergenic
1114817032 14:25971318-25971340 CTTCCCACAGCTTTACTTCTAGG + Intergenic
1115429410 14:33299236-33299258 GAGCCCACATCTTAGCTTCTGGG + Intronic
1116661213 14:47712454-47712476 GTGCCCAGTGCTTTTATTTTTGG - Intergenic
1117602836 14:57391707-57391729 CTGGCCACAGCTGTGCTTCTTGG + Exonic
1117644982 14:57842425-57842447 GACCCCATAGCTTAGCTTCTAGG - Intronic
1118038151 14:61890280-61890302 GTTCCCAGAGCTTTGGATATGGG + Intergenic
1118829104 14:69412610-69412632 GTCCCCAGTGCTTTGCTTGGTGG + Intronic
1118899227 14:69972745-69972767 AAGCCCAAAGCTTTGTTTCTGGG - Intronic
1122170989 14:99875608-99875630 GAGCCCAGAGCACAGCTTCTGGG - Intronic
1123015040 14:105369499-105369521 GTGCCCAGCACCTTCCTTCTGGG + Intronic
1124597117 15:31100817-31100839 GTGTCCAGCCCTCTGCTTCTGGG + Intronic
1128658663 15:69481848-69481870 ATGCTTAAAGCTTTGCTTCTTGG + Intergenic
1131094119 15:89645366-89645388 GGGCCCAGAGCTTTGCCTTGAGG - Exonic
1133033223 16:3021390-3021412 GGGCCGAGAGCTTTGCATCTGGG + Intronic
1139110572 16:63885883-63885905 GTGCCTAAAGATGTGCTTCTCGG - Intergenic
1141697036 16:85625051-85625073 GTGTCCAGAGCTGTGACTCTGGG - Intronic
1144209837 17:13004897-13004919 GTGGCAAGAGCTGTGTTTCTGGG - Intronic
1144438752 17:15262893-15262915 ATGCCCAGGGCTGGGCTTCTGGG + Intronic
1146500411 17:33359549-33359571 GAGCCCTGAGCATTGCTACTTGG - Intronic
1146956558 17:36939473-36939495 GAGCACGGAGCTTTGCTTCATGG - Intronic
1147460288 17:40563990-40564012 GTGCCCAGTGGTGTGCTACTGGG - Intronic
1147586439 17:41656081-41656103 GGGCCCAGAGCTGGGCTCCTAGG - Intergenic
1149037069 17:52146752-52146774 ATGCCCACAGCTTTTCTTCTTGG + Intronic
1149094532 17:52824888-52824910 TTGCCCAGAGGTTTCCTTTTTGG - Intergenic
1149660517 17:58332037-58332059 CTCCCCAGAGCCTTGATTCTCGG + Intergenic
1150295123 17:64003314-64003336 GTCCCCAGAGCTCTGCTGCTTGG - Intronic
1150448240 17:65244185-65244207 GTCCCCAGTTCTCTGCTTCTAGG - Intergenic
1203170808 17_GL000205v2_random:146558-146580 GTGACTAGAGCTGAGCTTCTTGG - Intergenic
1153803394 18:8691178-8691200 GTGCCAAGAGCTTGGGCTCTGGG - Intergenic
1153811068 18:8752090-8752112 GACCCCAGAGCTTTGACTCTAGG + Intronic
1157102328 18:44742307-44742329 GTGCCATTAGCTTTGCTCCTTGG + Intronic
1162487196 19:10968315-10968337 GTTTCCAGAGCTTTGCTTTTGGG + Intronic
1163830814 19:19546424-19546446 CTGCCCCGAGCTTTGTTTTTGGG + Exonic
1167089319 19:47332528-47332550 TTGACAAGAGCTTTGCTGCTGGG - Intronic
928938702 2:36706175-36706197 CTTCCCAGAGCTTGGCTTCAGGG + Intronic
929588892 2:43132740-43132762 GCCACCAGAGCTTTGCGTCTTGG - Intergenic
931375726 2:61706103-61706125 CTGCCTAGAGCTTCCCTTCTTGG - Intergenic
932613562 2:73217562-73217584 ATGCCCAGGGCTTTGCCTCCTGG + Intronic
933406366 2:81865252-81865274 GTGCCCAATGATTTGGTTCTTGG + Intergenic
937069609 2:119053195-119053217 GTGCCCAGAGCTCCGCTGCCGGG - Intergenic
937619840 2:123972813-123972835 GATCCCAGAGCTTTGAATCTAGG + Intergenic
939200090 2:139022857-139022879 GTGGCCTGAGCTTTCCTTCATGG + Intergenic
940971728 2:159903742-159903764 GTGCAGAGAACTTTGTTTCTTGG - Intronic
941695960 2:168551009-168551031 GTGCCAGGAGCTTGGATTCTTGG - Intronic
947991441 2:234490971-234490993 GTCTCCAGAGCTTGGGTTCTTGG - Intergenic
1168791292 20:578072-578094 GGGCCCAGAGCCTTAATTCTGGG + Intergenic
1168930369 20:1618682-1618704 GTGCCCAGCCCTGTGGTTCTGGG + Intronic
1168938036 20:1685061-1685083 GTGCCCAGCCCTGTGATTCTGGG + Intergenic
1169548648 20:6678519-6678541 GTTTCCAGAGCTTTGGTTCCTGG + Intergenic
1169753702 20:9021784-9021806 AAACCCAGAGATTTGCTTCTGGG - Intergenic
1169763222 20:9120081-9120103 GTGCCCACAGCTCTGCTGCTGGG - Intronic
1172640122 20:36435851-36435873 GGGCCTAGGGCATTGCTTCTGGG + Intronic
1173183227 20:40820224-40820246 TCGTCCAGAGCCTTGCTTCTGGG + Intergenic
1175307478 20:57986891-57986913 TTGCCCAGAGTTTTGCAGCTTGG - Intergenic
1176338503 21:5621200-5621222 GTTCCCTGAGCTTTGCCTATAGG + Intergenic
1176339911 21:5684273-5684295 GTTCCCTGAGCTTTGCCTATAGG + Intergenic
1176472165 21:7116426-7116448 GTTCCCTGAGCTTTGCCTATAGG + Intergenic
1176495726 21:7498204-7498226 GTTCCCTGAGCTTTGCCTATAGG + Intergenic
1176504916 21:7640183-7640205 GTTCCCTGAGCTTTGCCTATAGG - Intergenic
1178723383 21:35029790-35029812 GTGCCCCCAACTCTGCTTCTAGG + Intronic
1179166045 21:38935892-38935914 GTGCCTGGAGCTTTGCTTTTTGG - Intergenic
1180695138 22:17747131-17747153 GGGCCCAGTGCTTGGCTTCACGG - Intronic
1182421549 22:30250974-30250996 GTGCCCGGAGCGCTGTTTCTGGG - Intergenic
1183306768 22:37086901-37086923 CTGCCCAGAGCTTGGCGCCTGGG + Intronic
1183563984 22:38599686-38599708 ATTCCCTGACCTTTGCTTCTGGG + Intronic
1183879895 22:40818753-40818775 GTGCCCAGAGCTATCCTACTAGG + Intronic
1184341937 22:43891025-43891047 GTGCCCAGGGCTTGGCTGGTGGG - Intronic
1184550541 22:45202199-45202221 CTGCCCAGAGCTGTAGTTCTTGG - Intronic
1185131746 22:49043401-49043423 ATGCCACTAGCTTTGCTTCTGGG - Intergenic
950032812 3:9863307-9863329 GAGCCCAGAGGTTTGCCCCTGGG + Intergenic
950306039 3:11915821-11915843 GAGCCCAGAGGTTTGCCCCTAGG + Intergenic
952344271 3:32469317-32469339 CTGCCCAGAGCTTTGCCCATTGG - Intronic
954445805 3:50546198-50546220 GTGCCCTGAGCCTTGCGTCCTGG - Intergenic
955338801 3:58108942-58108964 GTGGCCAAAGCTTTGTTTTTGGG + Intronic
955340896 3:58124252-58124274 GTGCCAAGAACCTTGGTTCTGGG + Intronic
955525171 3:59812432-59812454 ATGCCCAGCGCTTGGCTTTTAGG - Intronic
955702665 3:61697339-61697361 GTTCCCAAATCCTTGCTTCTGGG - Intronic
958894328 3:99813358-99813380 GTGCCCAGAACTTTCCTCCATGG - Intergenic
961102967 3:124217488-124217510 GTACACAGACCTTTGCTTCTTGG + Intronic
961483997 3:127204853-127204875 GGGCCCAGAACTTAGCATCTGGG + Intergenic
961535403 3:127567588-127567610 GGGCCCCGAGCCTTGTTTCTTGG - Intergenic
961785542 3:129344633-129344655 GAGCCCAGAGGTTTGCCCCTGGG + Intergenic
963384575 3:144574436-144574458 GTGCTTAGAGCTTTTATTCTGGG - Intergenic
964559704 3:157980646-157980668 GTGTCCAAAGCTTTGTTTTTTGG - Intergenic
967521399 3:190436867-190436889 ATGCCCAGAGCTGTGCTTTTTGG - Intronic
968225048 3:196968238-196968260 GTGCTCAGAGCTTTGCAGCGTGG + Intronic
968690592 4:1987878-1987900 GTGCCGTGAGCCTTGCTTTTGGG - Intronic
968867962 4:3225811-3225833 GTGCACTGAGCTTTTCTCCTGGG - Intronic
969513887 4:7635740-7635762 GTGCTCAGAGCTGTGCTTCTTGG - Intronic
969524716 4:7698319-7698341 GTGCCCAGAGCATTGCTGTGTGG - Intronic
972032655 4:34480705-34480727 ATTCTCAGAGCTTTGCTGCTGGG + Intergenic
975337672 4:73199151-73199173 GTGCCCTGAGCCTTTCTTCATGG + Intronic
976805556 4:89042239-89042261 GTACTTAGAGCTTAGCTTCTGGG - Intronic
977192895 4:94022535-94022557 GTGCCTAGAGTTTCCCTTCTTGG - Intergenic
978056494 4:104274940-104274962 GAGCCCAGAGGTTAGATTCTGGG - Intergenic
980936749 4:139233121-139233143 GTGCCCTGCTCTTTGTTTCTAGG - Intergenic
981554103 4:145973429-145973451 GTGCCTAGAGATTTCTTTCTTGG - Intergenic
981751709 4:148098636-148098658 GTGCCCTGAGCATTGATTTTAGG + Intronic
982118762 4:152119148-152119170 TTGCACAGAGGTTTGCTTCAAGG + Intergenic
982617333 4:157655715-157655737 GTCCTCACAGCTTTGCTTCTCGG + Intergenic
983975625 4:173930309-173930331 CTGGCCAGAGCTTTCCTTTTAGG - Intergenic
984648111 4:182241188-182241210 CTTCCCAGAGCTCAGCTTCTGGG + Intronic
986596979 5:9432840-9432862 GATCACAGTGCTTTGCTTCTTGG - Intronic
987870947 5:23615697-23615719 GTGGCAACAGCTTAGCTTCTAGG - Intergenic
990515329 5:56526173-56526195 TTGTCCAGAGCTTGACTTCTTGG - Intronic
992052892 5:72956684-72956706 GCGCCCAGGACTTTGCCTCTGGG + Intronic
996293825 5:121888368-121888390 GAGCCCAGAGATTTGCTTAAAGG + Intergenic
996563527 5:124856149-124856171 GTTTTCAGAGCTTTGCTCCTTGG + Intergenic
997338645 5:133125284-133125306 ATGCCCAGTGTTTTGCTTATGGG + Intergenic
998537541 5:142948487-142948509 GTGCCCAGAGCTCTGGTTCCTGG + Intronic
1000380066 5:160620916-160620938 GTCCCCAGAGCCTTGCTTGAGGG + Exonic
1000872501 5:166594212-166594234 CTGTAAAGAGCTTTGCTTCTTGG - Intergenic
1001949911 5:175809056-175809078 GTGCCCTTACCTTTGCTTCCTGG - Exonic
1003198906 6:3940868-3940890 GTCCCCAGTGCTTTGCTGCCTGG - Intergenic
1003351875 6:5325424-5325446 GTTCCCAGTGCTTTGCTGCCTGG + Intronic
1003427522 6:6007502-6007524 GCGCCCAGAGCTCAGCTGCTGGG - Intronic
1005297767 6:24443427-24443449 CTGCCCTCAGCTTTCCTTCTGGG + Intronic
1008174101 6:48245465-48245487 GTGCCTATTGCCTTGCTTCTTGG - Intergenic
1013104806 6:107018108-107018130 GAACCCAGAGCTTTGCATGTTGG - Intergenic
1013303944 6:108830885-108830907 CATCCCAGATCTTTGCTTCTTGG - Intergenic
1016886869 6:148967275-148967297 GAGCCCAGTGCTTTCCTGCTGGG - Intronic
1017519550 6:155189809-155189831 GAGCCCTGTGCCTTGCTTCTGGG - Intronic
1017955431 6:159173853-159173875 GTGCCCACATCCTTGGTTCTCGG + Intronic
1019377112 7:698696-698718 GTGCGCACAGCTATGCATCTGGG + Intronic
1021239428 7:18182097-18182119 GTGCCTAGATCTTGGCTCCTGGG - Intronic
1024113794 7:46173319-46173341 GTGGCCACAGCTTTGTTTGTGGG + Intergenic
1028786923 7:94805670-94805692 GTGCCAACAGATTTGATTCTTGG - Intergenic
1029680030 7:102102097-102102119 GTGCACAGAGCATTTCTTCCAGG + Intronic
1029745936 7:102515961-102515983 CTGCTCAGTGCTTTGCCTCTGGG - Intronic
1029763874 7:102614940-102614962 CTGCTCAGTGCTTTGCCTCTGGG - Intronic
1029968780 7:104768646-104768668 GTGCCGAGGGCTTTGCTTGCTGG - Intronic
1029989722 7:104952215-104952237 GAGCCCAGTGATTTGGTTCTGGG + Intergenic
1032127205 7:129203671-129203693 GAGCCCAGAGCTTTGTCTCCTGG + Intronic
1032171788 7:129590985-129591007 TTGCCCACAGGATTGCTTCTGGG - Intergenic
1032514773 7:132498737-132498759 GAACCAAGAGCTTTGCTTCTGGG + Intronic
1033463984 7:141574293-141574315 GTACCCAGAGCTTTGCCTGATGG + Intronic
1033497233 7:141911225-141911247 GTGACCAGTGCTTATCTTCTTGG + Intronic
1034424739 7:151008652-151008674 GTGCCAAGCACTATGCTTCTCGG + Intronic
1036910852 8:12755637-12755659 GGGCCCAGCGCTTGGCTCCTCGG - Intronic
1037816544 8:22115567-22115589 GTGCCCAGAGTGGTGCTTGTGGG + Exonic
1041755812 8:61312149-61312171 GTGCCAGGGGCTTTCCTTCTCGG - Intronic
1044409375 8:91867480-91867502 CTGCCCAGGGGTTTGCTTCCAGG - Intergenic
1045578368 8:103450560-103450582 CTGCCCAGGACTTTGCATCTGGG + Intergenic
1046092495 8:109519969-109519991 TTCCCAAGAGGTTTGCTTCTAGG + Intronic
1046388382 8:113534641-113534663 TTGCTCAGAGCTTGGCTTCAGGG + Intergenic
1047579046 8:126192481-126192503 GACCCCAGAGCTTTTCTTCTAGG - Intergenic
1047599352 8:126410730-126410752 TTACCCAGAGCTGTTCTTCTGGG + Intergenic
1050035371 9:1430031-1430053 ATGCTTAGACCTTTGCTTCTGGG - Intergenic
1056817643 9:89813024-89813046 CTGCCCAGGGCATTGCATCTGGG + Intergenic
1057196864 9:93120366-93120388 GTGCCACGAGCTCAGCTTCTCGG + Intergenic
1060239907 9:121894110-121894132 GTGCCCAGTGCTTGGCATATAGG - Intronic
1060802157 9:126551549-126551571 GTCCCCAGAGCTGTGTTCCTGGG - Intergenic
1060851937 9:126885183-126885205 CTGCCCAGTGCTTGACTTCTCGG + Exonic
1062730121 9:138103986-138104008 GTGGACAGAGCTCTCCTTCTTGG - Intronic
1203423156 Un_GL000195v1:13720-13742 GTTCCCTGAGCTTTGCCTATAGG - Intergenic
1186362068 X:8852746-8852768 GTGCCCAGAGCTGGGCTTGGAGG - Intergenic
1186606522 X:11098438-11098460 GGGCCCAGGGCTTTTCTCCTAGG + Intergenic
1192392659 X:70746807-70746829 GACCCCAGAGGTTTTCTTCTTGG - Intronic
1195853057 X:109304001-109304023 TAGCCCAGAGGTTTGATTCTAGG - Intergenic
1199072788 X:143498203-143498225 GGGCCCAGGGCCTTGCTGCTTGG - Intergenic
1200950524 Y:8894337-8894359 TGGACCAAAGCTTTGCTTCTAGG + Intergenic