ID: 1077523527

View in Genome Browser
Species Human (GRCh38)
Location 11:3050348-3050370
Sequence TGTGCCCAGAGCTTTGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077523527_1077523528 -5 Left 1077523527 11:3050348-3050370 CCAGAAGCAAAGCTCTGGGCACA 0: 1
1: 0
2: 0
3: 15
4: 225
Right 1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG 0: 1
1: 0
2: 1
3: 3
4: 87
1077523527_1077523533 25 Left 1077523527 11:3050348-3050370 CCAGAAGCAAAGCTCTGGGCACA 0: 1
1: 0
2: 0
3: 15
4: 225
Right 1077523533 11:3050396-3050418 CCCCTTTACAAGTTATCCTTAGG 0: 1
1: 0
2: 0
3: 6
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077523527 Original CRISPR TGTGCCCAGAGCTTTGCTTC TGG (reversed) Intronic
903972907 1:27130791-27130813 TGAGGGCAGAGCTTGGCTTCTGG - Intronic
908825960 1:68132883-68132905 TGTGTGCAGGGCTTTGCTGCTGG + Intronic
909063105 1:70901913-70901935 TCTGCCCTGAGCTTTGATTTAGG - Intronic
914690210 1:150019299-150019321 TGTGACCAGATCTTAGTTTCAGG - Intergenic
914913278 1:151803171-151803193 TGTACCCATAGTTTTGCTTAAGG + Intronic
915741503 1:158121992-158122014 TGTACCCAGATCTTGGCTTCCGG + Intergenic
916019504 1:160779631-160779653 TGTCCCAAGAACTCTGCTTCAGG + Intergenic
916520362 1:165557972-165557994 TCTGCCCAGGGCTGTGCTGCAGG - Intronic
919768554 1:201142707-201142729 TGTCCCCAGGGCCTTGCTGCTGG - Intronic
921938310 1:220814976-220814998 TTTGCTCAGAACTTTACTTCAGG - Exonic
923921120 1:238565453-238565475 GGTGCCCAGACGTGTGCTTCAGG + Intergenic
1063540472 10:6928525-6928547 TATCCACAGAGCTTTGTTTCAGG - Intergenic
1064019799 10:11799835-11799857 TGTGCCCAGGTCTGTGCTTTTGG + Intergenic
1065454566 10:25893408-25893430 TCTTCCCATAGCTCTGCTTCTGG - Intergenic
1066446684 10:35490553-35490575 TGCTCCCCGAGCTTTGCTTGGGG + Intronic
1067054499 10:43043020-43043042 ATGGCACAGAGCTTTGCTTCTGG - Intergenic
1069887353 10:71632408-71632430 TGTACTCAGAGCTATGCTTTAGG + Intronic
1070814663 10:79315177-79315199 TCGGCCCAGAGCTTCCCTTCCGG + Exonic
1072822780 10:98574644-98574666 TGCTCCCTGGGCTTTGCTTCAGG - Intronic
1074998965 10:118781421-118781443 TGTGCTCAGAGCTTTACATAAGG - Intergenic
1076431015 10:130402397-130402419 TGTGGCCAGAGCTCTGCAGCTGG + Intergenic
1076854264 10:133108236-133108258 TGGCCCCAGAGCTCTGCCTCGGG + Intronic
1077255210 11:1578561-1578583 TGTACACTGAGCTTTGCATCTGG - Intergenic
1077523527 11:3050348-3050370 TGTGCCCAGAGCTTTGCTTCTGG - Intronic
1078080150 11:8198227-8198249 TGTGCCAAGAACTGTGCTGCAGG - Intergenic
1078149702 11:8748174-8748196 TGTGACCAGAGCTTTAGTTGGGG - Intronic
1080201842 11:29680723-29680745 TTTGTCCAGAGCTTTGCAGCAGG - Intergenic
1081476369 11:43436344-43436366 TTTGACCTGAGCTGTGCTTCTGG + Intronic
1083104434 11:60344488-60344510 TGTGCCCAGAGATTGTTTTCAGG - Intronic
1083167953 11:60903055-60903077 TGTGCCCAGTGGTTCGCTTGGGG - Intronic
1083287240 11:61668002-61668024 TATCCCCAGAGCTTGGCTGCTGG - Intergenic
1083715965 11:64577167-64577189 TGTCCCCAAAGCTCTGCTCCAGG + Intergenic
1083900016 11:65638981-65639003 TGTGCCCAGAGCTTGGCTCATGG + Intronic
1083909337 11:65696885-65696907 TGTGTCCAGAACTAGGCTTCTGG - Intergenic
1084215070 11:67642653-67642675 TGTGCTCAGAGCTGTGCCTCAGG + Exonic
1084536518 11:69760658-69760680 AGTGCCCACATCTTTGCCTCTGG - Intergenic
1086150316 11:83601859-83601881 TGATCACAGATCTTTGCTTCTGG + Intronic
1086947670 11:92859428-92859450 TTTGCCCAGAAGTCTGCTTCTGG - Intronic
1087749999 11:101996798-101996820 TGTTCCCATAGGTTTCCTTCTGG + Intronic
1087900836 11:103638573-103638595 TGTTCTCAGATCTTTGTTTCAGG + Intergenic
1089303040 11:117509968-117509990 TGTGGCCAGAGCAGGGCTTCTGG - Intronic
1090830822 11:130419790-130419812 AGCGCTCAGAACTTTGCTTCTGG - Intronic
1092346637 12:7721015-7721037 TGAGCCCAGAGATTTGCTTGAGG + Intergenic
1094365583 12:29676638-29676660 TGTGCCCAGTGCATCGCTCCTGG - Intronic
1095640553 12:44481050-44481072 TGTGCCCAGAGATTGTTTTCAGG + Intergenic
1097519106 12:60645869-60645891 TGTGCCCAGAGATTGTTTTCAGG - Intergenic
1099162660 12:79262969-79262991 TGTGCTCCAAGCTTTGCTCCAGG - Intronic
1099545075 12:83969173-83969195 TGTGGCCAGAGCTATGCCACAGG - Intergenic
1104177210 12:126344397-126344419 TCTGCTCAGAGCTTTGCCTCTGG + Intergenic
1107811262 13:44201930-44201952 ATTGCCCAAATCTTTGCTTCTGG + Intergenic
1108709312 13:53017249-53017271 TGGGCCCTAACCTTTGCTTCTGG + Intergenic
1110683373 13:78342902-78342924 AATGACCAGAGCTTTGTTTCAGG - Intergenic
1110706554 13:78605860-78605882 TGAGGCCAGATCTTTGCTTGGGG + Intergenic
1112503406 13:99958794-99958816 TGTGCCAAAAGCTGTGCTTGGGG + Intergenic
1113798231 13:113071655-113071677 TGTGCCCAGAGCTTTGACAACGG - Intronic
1114162479 14:20184334-20184356 GCTGCCCAGAGCTTTCCTTCAGG + Intergenic
1115429409 14:33299235-33299257 TGAGCCCACATCTTAGCTTCTGG + Intronic
1118899228 14:69972746-69972768 TAAGCCCAAAGCTTTGTTTCTGG - Intronic
1121839920 14:97125156-97125178 TGTGCCCAGTGCTATACTTGGGG + Intergenic
1124597116 15:31100816-31100838 TGTGTCCAGCCCTCTGCTTCTGG + Intronic
1128978433 15:72169480-72169502 TGTGGCCTGAGCTCTGCTGCGGG + Intronic
1129827408 15:78642874-78642896 AGTGGCCAGTGCATTGCTTCTGG + Intronic
1130009235 15:80135554-80135576 TTTGAGCAGAGCTTTGCTTTAGG + Intronic
1130928280 15:88401420-88401442 TGTGCCCAGACCTCTGCTCTTGG + Intergenic
1131051187 15:89349189-89349211 TCTGCCCAAAGCCTTTCTTCTGG - Intergenic
1131485809 15:92819622-92819644 TGTGTCAAGAGCTCTACTTCCGG + Intergenic
1131506783 15:93026567-93026589 AGTCACCGGAGCTTTGCTTCAGG - Exonic
1132309396 15:100846017-100846039 GGAGAACAGAGCTTTGCTTCTGG + Intergenic
1133015020 16:2935715-2935737 TGTGCCGTCAGCTTTGCTTGAGG + Intronic
1133033222 16:3021389-3021411 GGGGCCGAGAGCTTTGCATCTGG + Intronic
1135823879 16:25709123-25709145 TGTCACCAGATCTCTGCTTCTGG + Intronic
1138023613 16:53505134-53505156 TGTGGCCAGAGACTTACTTCTGG - Intergenic
1138363016 16:56448959-56448981 TATGCCTAGAACTTGGCTTCTGG - Intronic
1138468948 16:57216483-57216505 TAAGGCCAGAGCATTGCTTCAGG + Intronic
1139491069 16:67286330-67286352 TGTGCCCATAGCTTGACATCAGG - Exonic
1141005676 16:80349481-80349503 TCTGCCCAGAGTTTGGCTCCAGG - Intergenic
1142597767 17:1037836-1037858 GGCTCCCAGGGCTTTGCTTCTGG - Intronic
1143973255 17:10811264-10811286 TGTGCACAGAGCTTCATTTCAGG - Intergenic
1144016900 17:11204747-11204769 TTTGGCCAGAGCATTGCTGCTGG - Intergenic
1144209838 17:13004898-13004920 TGTGGCAAGAGCTGTGTTTCTGG - Intronic
1144312058 17:14022966-14022988 TGTGGCCTGAGCTTGGCCTCAGG + Intergenic
1144332701 17:14238353-14238375 TGTGGCCTGAGCTTGGCCTCAGG - Intergenic
1144662129 17:17077945-17077967 TGGCCCCAGAGCTTGGCTTCTGG - Intronic
1148388274 17:47252416-47252438 TGTGACCTGAACTTTGCTCCAGG + Intergenic
1150412656 17:64959824-64959846 AGTTTTCAGAGCTTTGCTTCTGG - Intergenic
1150799217 17:68265609-68265631 AGTTCTCAGAGCTTTGCTTCTGG + Intronic
1151820294 17:76493356-76493378 TGTGCCATGAGCTGTCCTTCCGG - Intronic
1154334440 18:13454690-13454712 TGTGCCCAGACCTGTGGCTCAGG - Intronic
1155797143 18:30054452-30054474 TGTGCCTTGAGCTTTGCCTATGG - Intergenic
1156658649 18:39318675-39318697 TGTGCCCAGGGTTTTGCAGCTGG + Intergenic
1157581031 18:48774271-48774293 TGTGCCCATGGTTCTGCTTCTGG - Intronic
1159130202 18:64272434-64272456 TGTGCCTTGACCTTTGATTCTGG - Intergenic
1162487195 19:10968314-10968336 GGTTTCCAGAGCTTTGCTTTTGG + Intronic
1162943986 19:14031485-14031507 TGTGCCCAGAGCTCTCCTAGGGG - Intergenic
1165060653 19:33203803-33203825 TGAGCCCAGAGCATGGTTTCTGG + Intronic
1166426763 19:42685887-42685909 TGTGCCCAGAGATTGTTTTCAGG - Intronic
1167089320 19:47332529-47332551 TTTGACAAGAGCTTTGCTGCTGG - Intronic
925571576 2:5317907-5317929 TGAGGCCAGAGCTTGGCATCTGG - Intergenic
928938701 2:36706174-36706196 TCTTCCCAGAGCTTGGCTTCAGG + Intronic
929620704 2:43351177-43351199 TGTCCTCAGAGCTTGGCTTTAGG - Intronic
929933038 2:46273411-46273433 TCTGCCCAGAGATTTCCGTCAGG - Intergenic
929933135 2:46274026-46274048 TCTGCCCAGAGATTTCCTTCAGG + Intergenic
930035805 2:47084289-47084311 AGGGCCCAGACCTTTGCTGCAGG - Intronic
930627699 2:53716982-53717004 TGTGGCCAGAGGATTGCTTGAGG + Intronic
930796777 2:55401195-55401217 TGAGGCCAGAGAATTGCTTCAGG + Intronic
931818809 2:65931221-65931243 TGTGCCTAGAGATTTGTTTAGGG - Intergenic
932520082 2:72403078-72403100 TGAGCCCAGAGATTTACCTCAGG + Intronic
933302247 2:80555209-80555231 TGTGTCCAAAGCTTTGACTCTGG + Intronic
934683812 2:96305837-96305859 TGTCCCAAGACCTTTCCTTCCGG + Intergenic
935598587 2:104899291-104899313 TGAGCCCAGAGCAGAGCTTCGGG + Intergenic
936491783 2:112978490-112978512 TCTGCCCAGAGCTTCGTGTCAGG + Intronic
936496492 2:113026404-113026426 TGTCCCCAAAACTATGCTTCTGG - Intronic
937069610 2:119053196-119053218 TGTGCCCAGAGCTCCGCTGCCGG - Intergenic
938010265 2:127823198-127823220 TGTGCTCAGAGTTTTTTTTCAGG + Intergenic
939241924 2:139572519-139572541 GGTGGCCAGAGCTGTGCTTGGGG - Intergenic
940989530 2:160083916-160083938 TGTGCCCAGAGATTGTTTTCAGG - Intergenic
944405467 2:199378965-199378987 TGTGCCATGAGCTTTGTTCCAGG - Intronic
945620754 2:212133730-212133752 TGAGGCCAGAGGATTGCTTCAGG + Intronic
946288235 2:218721763-218721785 TGTGCTCAAAGCTTTCATTCTGG + Intronic
947267973 2:228303535-228303557 TGTGCCCAGAGATTGTTTTCAGG - Intergenic
1168789619 20:567549-567571 TGTTCTCAGAGCTTTGGTTGTGG + Intergenic
1168791291 20:578071-578093 TGGGCCCAGAGCCTTAATTCTGG + Intergenic
1168930368 20:1618681-1618703 TGTGCCCAGCCCTGTGGTTCTGG + Intronic
1168938035 20:1685060-1685082 TGTGCCCAGCCCTGTGATTCTGG + Intergenic
1169215139 20:3789193-3789215 CCTGCCCAGAGCTGTCCTTCAGG + Intronic
1169763223 20:9120082-9120104 AGTGCCCACAGCTCTGCTGCTGG - Intronic
1170694807 20:18648447-18648469 AGTGCCCAGTGCCTTGCTTGGGG + Intronic
1173183226 20:40820223-40820245 TTCGTCCAGAGCCTTGCTTCTGG + Intergenic
1175023645 20:55878217-55878239 TGTCTCCAGAGCTTTGAATCAGG - Intergenic
1175164819 20:57036002-57036024 TGTGCCTAGGGCTTTCCTCCAGG + Intergenic
1178067587 21:28922831-28922853 TGTGCCCATGGCATAGCTTCAGG - Intergenic
1178500658 21:33123378-33123400 TGGGCCCACATCCTTGCTTCTGG + Intergenic
1181461638 22:23089322-23089344 TGTCCCCAAAGCTTTGCTCAAGG - Intronic
1183306767 22:37086900-37086922 TCTGCCCAGAGCTTGGCGCCTGG + Intronic
1183784381 22:40021184-40021206 TGTGGCCAGACCCTTGCTGCAGG - Intronic
952332994 3:32381955-32381977 TGTGCACAGAGCTCTGTTTTGGG + Intergenic
954424661 3:50437068-50437090 TGGCCCCAGAGCTCTGCTTTTGG - Intronic
955145104 3:56309753-56309775 TGTGCCAAGCCCTGTGCTTCAGG - Intronic
955469294 3:59269526-59269548 TGTGCCCAGGACTTTGGTTCTGG + Intergenic
961262704 3:125615466-125615488 TGGGCCCGGAGCTTTGGTGCAGG - Intergenic
961483996 3:127204852-127204874 TGGGCCCAGAACTTAGCATCTGG + Intergenic
961775601 3:129282225-129282247 TGAGGCCAGAGAATTGCTTCAGG + Intronic
962951249 3:140221102-140221124 GGTCCCCTGAGCTTTGCTCCTGG - Intronic
963022757 3:140887747-140887769 TGTGTCCAGAGTTTTTCTTGGGG - Intergenic
963384576 3:144574437-144574459 TGTGCTTAGAGCTTTTATTCTGG - Intergenic
967324919 3:188229441-188229463 AGTGACCAATGCTTTGCTTCCGG - Intronic
967907454 3:194513381-194513403 TGTGCCCAGCCCTTTTCTTGAGG - Intergenic
968803973 4:2760806-2760828 TGTGTCCAGAGCTGTGGTTAGGG - Intergenic
969115471 4:4868308-4868330 TGTGCTCTGAGCTGAGCTTCTGG - Intergenic
969448894 4:7261793-7261815 TGTGCCCTGGGCTTTGCCTGGGG + Intronic
970280722 4:14452027-14452049 TGTGCCCAAAGCATCGCTTTGGG - Intergenic
970506556 4:16736129-16736151 CTTGCCCAGAGCTGAGCTTCAGG - Intronic
972041432 4:34605632-34605654 TGTGCATAAAGATTTGCTTCAGG + Intergenic
974081592 4:57219375-57219397 TGTGTCCAGAGCTTTTATTGGGG + Intergenic
974647619 4:64715282-64715304 TGTGCCCAGAGATTGTTTTCAGG - Intergenic
976805557 4:89042240-89042262 TGTACTTAGAGCTTAGCTTCTGG - Intronic
978585580 4:110272686-110272708 TATCCCCAGAGCTCTGCTTTTGG - Intergenic
983062760 4:163177083-163177105 TGTGCCCAGAGATTGTTTTCAGG + Intergenic
983064304 4:163191530-163191552 TGTGCCCAGAGATTGTTTTCAGG - Intergenic
983695216 4:170519669-170519691 TGGTCCCTGAGCCTTGCTTCTGG - Intergenic
984044118 4:174776261-174776283 CCTGGCCAGAGCTTTGCTTTAGG - Intronic
984927376 4:184818692-184818714 TGTGCCCAGAGCTTAGAGTGTGG + Intronic
988425551 5:31059098-31059120 TGAGCCCAGGGCATGGCTTCAGG - Intergenic
991134420 5:63164578-63164600 TGTGTCCAGAACATTGATTCTGG - Intergenic
992052891 5:72956683-72956705 TGCGCCCAGGACTTTGCCTCTGG + Intronic
993003270 5:82404225-82404247 TGTTGCCAGAGCACTGCTTCTGG + Intergenic
994190058 5:96859398-96859420 GTTGCCCAGAGCATTGCCTCAGG + Intronic
995715625 5:115079550-115079572 TGTGCCCAGAGATTGTTTTCAGG - Intergenic
998767041 5:145499902-145499924 TGTGCGCAAAGCTCAGCTTCTGG - Intronic
1000380065 5:160620915-160620937 CGTCCCCAGAGCCTTGCTTGAGG + Exonic
1001276234 5:170353737-170353759 TGTTCCCGGAGCCTGGCTTCAGG + Intronic
1001482526 5:172098368-172098390 TGTGCCCAGATCTTTCCCTTGGG - Intronic
1003164846 6:3667726-3667748 TGAGCCCAGAGTTTTCTTTCAGG - Intergenic
1003427523 6:6007503-6007525 TGCGCCCAGAGCTCAGCTGCTGG - Intronic
1003890892 6:10562769-10562791 TGTCCCCAGCCCTTGGCTTCAGG - Intronic
1004148024 6:13088339-13088361 AGTACTCAGAGCTGTGCTTCTGG + Intronic
1005170619 6:22980685-22980707 TGTGGCCAGAGCGTCTCTTCAGG + Intergenic
1005281916 6:24283616-24283638 TGTGGGGAGAGCTTAGCTTCTGG - Intronic
1006295157 6:33166977-33166999 AGTGCCCACTGCTCTGCTTCAGG - Intronic
1007048255 6:38799192-38799214 TGTGCCAAGAGCTCTGATTGTGG - Intronic
1008031707 6:46703408-46703430 TCTTCTCTGAGCTTTGCTTCTGG - Intronic
1008815405 6:55558727-55558749 TTTGCCCAGAGCTTACCCTCTGG - Intronic
1013602712 6:111719967-111719989 GGTACCCAGAGCTCTGGTTCAGG + Exonic
1014198698 6:118585702-118585724 TGTGCCCAGAGATTGTTTTCAGG + Intronic
1016947702 6:149549661-149549683 TGTGCCCAGAGATTGTTTTCAGG - Intergenic
1018607807 6:165616984-165617006 TTTTCCCATAGCTTTGATTCTGG - Intronic
1018886042 6:167938396-167938418 TGTGAGCTGAGCTGTGCTTCAGG + Intronic
1018988918 6:168658689-168658711 TGGGCCCAGAGCTGTGATTATGG + Intronic
1019377111 7:698695-698717 TGTGCGCACAGCTATGCATCTGG + Intronic
1020107853 7:5430428-5430450 TGTGCTCTGAGCCCTGCTTCAGG + Intergenic
1021331200 7:19340601-19340623 TGATCCCAGCGCTTTTCTTCTGG - Intergenic
1026104238 7:67408516-67408538 TGATGCCAGAGCTATGCTTCCGG - Intergenic
1026472141 7:70702766-70702788 GGTGGCCAGAGCGTTGCGTCTGG - Intronic
1026490020 7:70855271-70855293 AGTGCCTAGAGCGTTGCTTGAGG + Intergenic
1026765585 7:73157454-73157476 TGAGCCCAGATCATGGCTTCAGG + Intergenic
1027042058 7:74967147-74967169 TGAGCCCAGATCATGGCTTCAGG + Intronic
1027081583 7:75235207-75235229 TGAGCCCAGATCATGGCTTCAGG - Intergenic
1029660112 7:101954719-101954741 TGTGACCAGAGCAGTGATTCTGG - Intronic
1032514772 7:132498736-132498758 AGAACCAAGAGCTTTGCTTCTGG + Intronic
1033539928 7:142347142-142347164 TGCGCCCAGGACTCTGCTTCAGG - Intergenic
1033661652 7:143407265-143407287 TGAGACCAGTGCTTTGCTTGGGG - Intronic
1034534594 7:151719113-151719135 TGTTCCCCGAGCGTTGCTCCGGG + Intronic
1034551086 7:151821042-151821064 TGTCTCCACAGCTTTCCTTCTGG - Intronic
1037816543 8:22115566-22115588 TGTGCCCAGAGTGGTGCTTGTGG + Exonic
1038013476 8:23493758-23493780 AGTGCCCAGAGCAAGGCTTCAGG - Intergenic
1038363382 8:26905953-26905975 TGTCCCCAGAGCTTTGATTAGGG - Intergenic
1038780161 8:30563275-30563297 TGTGGCCAGAGTTTTGCTGATGG + Intronic
1039387706 8:37151077-37151099 TGTGCCCAGAGCTCTGGACCTGG - Intergenic
1046388381 8:113534640-113534662 ATTGCTCAGAGCTTGGCTTCAGG + Intergenic
1047605444 8:126469670-126469692 TGTAAACAGAGATTTGCTTCAGG - Intergenic
1047760611 8:127951311-127951333 TGTGCAGGGAGCTTTGCCTCAGG - Intergenic
1047783092 8:128125741-128125763 GGTGGCCAGAACTTTGCCTCAGG + Intergenic
1047800310 8:128302224-128302246 TGTTCCCAGGGCTTTGATTAGGG - Intergenic
1048179134 8:132179371-132179393 TGTGTCCAGTGGTTTGCTGCTGG - Intronic
1048666164 8:136663843-136663865 TATACCCAAAGCTTTGCTTCTGG - Intergenic
1049016563 8:139924265-139924287 TGTGCCCAGCGCTTGGCCTGCGG - Intronic
1049683031 8:143928124-143928146 TGTGGTCAGAGGCTTGCTTCAGG + Intronic
1050691523 9:8232747-8232769 CATGCCCAAAGCTTTGCTTCTGG - Intergenic
1051930693 9:22381534-22381556 TGAGACCAGAGCTATGCTGCAGG + Intergenic
1052109541 9:24564023-24564045 TGTGTATAGAGCTTTCCTTCTGG + Intergenic
1052263861 9:26548980-26549002 TGTGAACAGAGCTTTGTGTCAGG - Intergenic
1052369240 9:27645550-27645572 TGTGGCCAGAGCTCCTCTTCAGG + Intergenic
1052370710 9:27661235-27661257 TTCACCCAGAGATTTGCTTCTGG + Intergenic
1053886981 9:42650924-42650946 TGAGCCTAGGGCTCTGCTTCTGG - Intergenic
1054226001 9:62458374-62458396 TGAGCCTAGGGCTCTGCTTCTGG - Intergenic
1055551013 9:77432326-77432348 CTGCCCCAGAGCTTTGCTTCTGG - Intronic
1055767265 9:79677031-79677053 TGAGCCCAGATCTATCCTTCTGG - Intronic
1056031792 9:82560928-82560950 TGGGCACAGAGCTCTGATTCAGG + Intergenic
1057252931 9:93518591-93518613 TGTGCGCAGAGCTTGCATTCTGG + Intronic
1058837836 9:108875450-108875472 TGTGCCCAGAGGCTCGCTGCAGG - Intronic
1060802158 9:126551550-126551572 TGTCCCCAGAGCTGTGTTCCTGG - Intergenic
1060995355 9:127872606-127872628 TGTGCCGTGGGCTTTGCTGCTGG + Intronic
1062006738 9:134242241-134242263 TCTGCCCACATCTCTGCTTCAGG - Intergenic
1062060718 9:134493890-134493912 TGTGCCCAGACCCTTGTCTCGGG - Intergenic
1185579449 X:1198804-1198826 TCTGTCCAGAGTTTTCCTTCCGG + Intronic
1189321430 X:40089998-40090020 TGGGCCCTGAGGTTTGCTGCCGG - Intronic
1190465082 X:50718108-50718130 TGGGTCCAGAGCTTGGCTTTGGG + Intronic
1191041686 X:56088183-56088205 GTTGCCCTGAGCATTGCTTCTGG - Intergenic
1193511843 X:82411562-82411584 GGTGGCTAGAACTTTGCTTCTGG + Intergenic
1193560343 X:83010143-83010165 TGTGCCCAGAGATTGTTTTCGGG - Intergenic
1200144187 X:153917877-153917899 TCTGCCCAGTGCTCTGTTTCCGG - Intronic