ID: 1077523528

View in Genome Browser
Species Human (GRCh38)
Location 11:3050366-3050388
Sequence GCACACTCCCTAGCCAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 87}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077523520_1077523528 19 Left 1077523520 11:3050324-3050346 CCCACTCCAAGCAGCCACAGGCA 0: 1
1: 0
2: 0
3: 35
4: 279
Right 1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG 0: 1
1: 0
2: 1
3: 3
4: 87
1077523521_1077523528 18 Left 1077523521 11:3050325-3050347 CCACTCCAAGCAGCCACAGGCAC 0: 1
1: 0
2: 3
3: 40
4: 311
Right 1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG 0: 1
1: 0
2: 1
3: 3
4: 87
1077523523_1077523528 5 Left 1077523523 11:3050338-3050360 CCACAGGCACCCAGAAGCAAAGC 0: 1
1: 0
2: 6
3: 38
4: 292
Right 1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG 0: 1
1: 0
2: 1
3: 3
4: 87
1077523518_1077523528 22 Left 1077523518 11:3050321-3050343 CCACCCACTCCAAGCAGCCACAG 0: 1
1: 0
2: 5
3: 48
4: 426
Right 1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG 0: 1
1: 0
2: 1
3: 3
4: 87
1077523526_1077523528 -4 Left 1077523526 11:3050347-3050369 CCCAGAAGCAAAGCTCTGGGCAC 0: 1
1: 0
2: 1
3: 17
4: 208
Right 1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG 0: 1
1: 0
2: 1
3: 3
4: 87
1077523522_1077523528 13 Left 1077523522 11:3050330-3050352 CCAAGCAGCCACAGGCACCCAGA 0: 1
1: 0
2: 2
3: 40
4: 407
Right 1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG 0: 1
1: 0
2: 1
3: 3
4: 87
1077523527_1077523528 -5 Left 1077523527 11:3050348-3050370 CCAGAAGCAAAGCTCTGGGCACA 0: 1
1: 0
2: 0
3: 15
4: 225
Right 1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG 0: 1
1: 0
2: 1
3: 3
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077523528 Original CRISPR GCACACTCCCTAGCCAAAAC TGG Intronic
903764873 1:25727703-25727725 CCACACTCCCTGCCCAGAACTGG - Intronic
907049663 1:51321685-51321707 GCACACCCCCTACCCCAACCGGG + Intronic
908391748 1:63689405-63689427 GCACAGTGCCTGGCCACAACAGG + Intergenic
908591324 1:65638596-65638618 GCTCACTTCATAGCCACAACTGG - Exonic
909988237 1:82188859-82188881 GCAGACTCATGAGCCAAAACGGG - Intergenic
917925474 1:179786077-179786099 CCCCACTCCCTTGCCAAAAAGGG + Intronic
1067097159 10:43309271-43309293 ACACACTCCTTGACCAAAACAGG - Intergenic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1081267391 11:41042532-41042554 GCACACTTCCTTGCCGCAACTGG + Intronic
1085715426 11:78868726-78868748 GCACACTTCCCTTCCAAAACTGG + Intronic
1087222365 11:95560245-95560267 GCCCACTCCATAGTCACAACAGG + Intergenic
1087290154 11:96312295-96312317 GAAAACTCCAAAGCCAAAACAGG + Intronic
1095819302 12:46460031-46460053 GGACACTTTCTAGCCAAAAGTGG + Intergenic
1110578242 13:77085777-77085799 GCACACTATGTAACCAAAACAGG + Intronic
1110833972 13:80063428-80063450 ACTCACTTCATAGCCAAAACAGG - Intergenic
1111198545 13:84904920-84904942 GGACACTTCCTAGCCAATAAAGG - Intergenic
1115347662 14:32360696-32360718 ACACACTCAATGGCCAAAACTGG - Intronic
1116849966 14:49898855-49898877 GCACAGTCCCTATAAAAAACAGG - Intergenic
1122321067 14:100856176-100856198 GAACACTCCATAGGCAAACCTGG + Intergenic
1122502747 14:102212258-102212280 GTACACTCCTTGGCAAAAACTGG - Intronic
1122899090 14:104774747-104774769 GCACAGCCCCTAGCCCACACTGG + Intronic
1126914055 15:53445467-53445489 GCACACTCAGTATCCAACACAGG + Intergenic
1129178710 15:73858093-73858115 GCAGACACCCGAGCCAAAGCTGG + Intergenic
1130647736 15:85743567-85743589 GCACCTTCCATAGCCAAATCAGG + Exonic
1138798170 16:59994498-59994520 GGAAACTCCCAAGCCAAACCAGG + Intergenic
1140079304 16:71729632-71729654 CCACTCTCCCGAGCCAAAGCTGG + Intronic
1149477263 17:56973594-56973616 GCCCACTGCCTAGACAGAACCGG + Intergenic
1155474567 18:26225403-26225425 GCACTATGCCTAGCAAAAACGGG - Intergenic
1156381346 18:36564195-36564217 GCACACAGCCTCTCCAAAACAGG - Intronic
1158926426 18:62267931-62267953 CCACACTCCCTCCCCAAAAAAGG + Intronic
1162573251 19:11484359-11484381 GCACACTACCAAGCCAACATGGG + Intronic
1164087872 19:21920320-21920342 GCTCACTCCCTATCCAAAGGTGG + Intergenic
1167271349 19:48508309-48508331 GAACACACCCTTTCCAAAACAGG + Intronic
927498457 2:23565886-23565908 GCGCACTGCCTAGCCAAGAGGGG - Intronic
932444260 2:71764755-71764777 CCACTCTCACTAGCCAAATCTGG + Intergenic
933833821 2:86230478-86230500 GCCCGCTTCCTAGCCAAAGCAGG + Intronic
934906227 2:98206722-98206744 CCTCACTCCCTAGCCAAGAGTGG + Intronic
935283364 2:101539591-101539613 GCAGACTCCCAAGCCAGAATAGG + Intergenic
936428058 2:112436078-112436100 GCACACTTCCTTGCAAAATCCGG + Intergenic
936608239 2:113978377-113978399 TCACCCTCCCTAGCCCACACAGG - Intergenic
940499444 2:154475994-154476016 GCAGCCTCCTGAGCCAAAACAGG + Intergenic
945341299 2:208658758-208658780 GCACTCACCATAGCCAAAACTGG - Intronic
945684622 2:212953917-212953939 GCACACTCCCTGGCCACCATAGG + Intergenic
948334131 2:237194360-237194382 GCACAATCCCTGGCCCAAGCTGG + Intergenic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1174178126 20:48657706-48657728 GCACACGCCCCAGGCAAAGCCGG + Intronic
1175284476 20:57828819-57828841 GCCCACTACCCAGCCCAAACAGG - Intergenic
1175466337 20:59193025-59193047 GCACAGTCCCCACCCAAGACAGG + Exonic
1176374196 21:6079134-6079156 GCACACTTCCTTGCAAAATCCGG - Intergenic
1179749280 21:43459111-43459133 GCACACTTCCTTGCAAAATCCGG + Intergenic
1181972531 22:26702826-26702848 GCACACTGCCTAGAGAAAGCTGG - Intergenic
1183230763 22:36580499-36580521 CCACACTCCATAGCCAGAAGTGG - Intronic
1184080221 22:42214096-42214118 GCACACTGCCTTGCCCACACTGG + Exonic
1185184374 22:49388730-49388752 GCAAAAACCCTCGCCAAAACAGG - Intergenic
953036899 3:39220009-39220031 GCAGACTCCGTAGCCAATAATGG - Intergenic
959879658 3:111429079-111429101 GCACCCTCTGTAGCCAAAGCTGG - Intronic
965313743 3:167164423-167164445 GCCCTCTGCCTAGCCACAACAGG - Intergenic
967708133 3:192676266-192676288 TCACACTTCCTAGACAGAACAGG + Intronic
968291025 3:197539955-197539977 GCTCACTGCCTAGACAGAACCGG - Intronic
970820278 4:20204285-20204307 GGACTGTCCCTACCCAAAACTGG - Intergenic
972718501 4:41673186-41673208 GCTCAGTCCCAAGCCAATACTGG + Intronic
974372043 4:61029789-61029811 TCACATTCCCTAGCCACAGCAGG - Intergenic
980826371 4:138078493-138078515 GCACACTGACTAATCAAAACTGG + Intergenic
988989662 5:36658006-36658028 GCACATTGCCTGCCCAAAACAGG - Intronic
996347351 5:122501395-122501417 GCACATTGCCAAGGCAAAACAGG + Intergenic
997623164 5:135313789-135313811 TCACACCCTCTAGCCAACACAGG + Intronic
1000820404 5:165975672-165975694 GCAGACTCCCAAGCCAGAATAGG - Intergenic
1000833739 5:166132005-166132027 GCACACCTCCCAGCTAAAACGGG - Intergenic
1003520370 6:6853529-6853551 GCACCGTGCCTAGCCAAGACAGG - Intergenic
1005567271 6:27108969-27108991 GCACACTTCCTATACAAAATAGG + Intergenic
1010842288 6:80660480-80660502 GCACACTCACAAACCAATACAGG - Intergenic
1013312833 6:108913475-108913497 GAAGTCTTCCTAGCCAAAACAGG - Intronic
1017786701 6:157762679-157762701 GCATCCTCCCTAGCCACAGCGGG - Intronic
1018948061 6:168359606-168359628 GCAGCCTCCCGAGCCAGAACAGG - Intergenic
1018984044 6:168622348-168622370 GCAGCCTCCCAAGCCAGAACAGG - Intronic
1019737540 7:2658163-2658185 GCACACGGCCGAGCCAGAACTGG + Intronic
1023842957 7:44107068-44107090 GCCCTCTCCCTACCCAAAAGAGG - Intronic
1024381699 7:48704150-48704172 GCAGATTCCCTAACCACAACTGG - Intergenic
1026346479 7:69478780-69478802 CCACCCTGCCTGGCCAAAACAGG + Intergenic
1026561685 7:71455681-71455703 CCACACTCCCCAGCCAGCACGGG + Intronic
1033439074 7:141362357-141362379 GTACACTTCAAAGCCAAAACAGG - Intronic
1035115943 7:156524006-156524028 TCACACTCCCAAGCCCAAACAGG + Intergenic
1038707922 8:29912790-29912812 ACACACTCCCAAGACTAAACTGG + Intergenic
1039316603 8:36380252-36380274 GCACACTCCCTTCCCAACCCAGG - Intergenic
1060008051 9:120017935-120017957 CCACACTGCCTTGCAAAAACAGG + Intergenic
1062271552 9:135712153-135712175 GCACACCCCCTAGACAAGGCCGG - Intronic
1186079878 X:5919502-5919524 GCCCAGTCCCTAACCAAAACTGG - Intronic
1192373958 X:70540038-70540060 GCCCACTCCCTTGCTAAAGCAGG + Intronic
1193095247 X:77541245-77541267 GCACCCTCCCAAGTCTAAACCGG + Intronic
1193365240 X:80623604-80623626 CCCCACTCCCTAGCCAAAACAGG - Intergenic
1198442982 X:136682708-136682730 GCAGACCCCCTAACGAAAACAGG - Intronic
1201743145 Y:17344600-17344622 GCACACTTCCCAGCTAAAGCAGG - Intergenic