ID: 1077524771

View in Genome Browser
Species Human (GRCh38)
Location 11:3057448-3057470
Sequence CCCGGAAGACGGGCCCGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 137}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077524771_1077524784 14 Left 1077524771 11:3057448-3057470 CCACGCCGGGCCCGTCTTCCGGG 0: 1
1: 0
2: 0
3: 17
4: 137
Right 1077524784 11:3057485-3057507 TAGGCAACTACCAGGGGCTCCGG 0: 1
1: 0
2: 0
3: 10
4: 100
1077524771_1077524783 8 Left 1077524771 11:3057448-3057470 CCACGCCGGGCCCGTCTTCCGGG 0: 1
1: 0
2: 0
3: 17
4: 137
Right 1077524783 11:3057479-3057501 GGTCGCTAGGCAACTACCAGGGG 0: 1
1: 0
2: 0
3: 2
4: 36
1077524771_1077524787 29 Left 1077524771 11:3057448-3057470 CCACGCCGGGCCCGTCTTCCGGG 0: 1
1: 0
2: 0
3: 17
4: 137
Right 1077524787 11:3057500-3057522 GGCTCCGGATGTCGCCGGCCCGG 0: 1
1: 0
2: 1
3: 10
4: 62
1077524771_1077524782 7 Left 1077524771 11:3057448-3057470 CCACGCCGGGCCCGTCTTCCGGG 0: 1
1: 0
2: 0
3: 17
4: 137
Right 1077524782 11:3057478-3057500 CGGTCGCTAGGCAACTACCAGGG 0: 1
1: 0
2: 0
3: 2
4: 17
1077524771_1077524778 -5 Left 1077524771 11:3057448-3057470 CCACGCCGGGCCCGTCTTCCGGG 0: 1
1: 0
2: 0
3: 17
4: 137
Right 1077524778 11:3057466-3057488 CCGGGACACGCCCGGTCGCTAGG 0: 1
1: 0
2: 0
3: 2
4: 37
1077524771_1077524781 6 Left 1077524771 11:3057448-3057470 CCACGCCGGGCCCGTCTTCCGGG 0: 1
1: 0
2: 0
3: 17
4: 137
Right 1077524781 11:3057477-3057499 CCGGTCGCTAGGCAACTACCAGG 0: 1
1: 0
2: 0
3: 0
4: 33
1077524771_1077524786 24 Left 1077524771 11:3057448-3057470 CCACGCCGGGCCCGTCTTCCGGG 0: 1
1: 0
2: 0
3: 17
4: 137
Right 1077524786 11:3057495-3057517 CCAGGGGCTCCGGATGTCGCCGG 0: 1
1: 0
2: 0
3: 8
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077524771 Original CRISPR CCCGGAAGACGGGCCCGGCG TGG (reversed) Intronic
900349210 1:2227112-2227134 CCCGAACGCCGGGCCCCGCGGGG + Intergenic
900597564 1:3489468-3489490 CCTGGAAGAAGGGCCCAGAGTGG - Intergenic
900739908 1:4324545-4324567 CCTGGAAGACGGGCAGGGTGGGG - Intergenic
902431493 1:16367117-16367139 CCCGGAAGAGGCGCCAGGCAAGG - Exonic
903017139 1:20368493-20368515 CCAGGAAGAGGGGCCAGCCGGGG - Intergenic
903078109 1:20787344-20787366 CGCGGGAGGCGGGGCCGGCGGGG - Intergenic
903188142 1:21640878-21640900 CCCACAAGACAGGCCCGGTGGGG - Intronic
903251115 1:22053364-22053386 CCCAGAGGACGCGGCCGGCGCGG - Intronic
903778439 1:25807631-25807653 CCAGGAAGGCGGGCTCGGCCTGG + Intronic
904641920 1:31937861-31937883 CCCGGAAGGAGGGCCGGGCCGGG - Intronic
915318396 1:155042685-155042707 CCTGGAGGACAGGCCCGGGGAGG + Intronic
920184656 1:204152238-204152260 CCGGGAAGCCAGCCCCGGCGGGG - Intergenic
920216220 1:204363146-204363168 CCCGGAGGAGGGGCCCTGGGAGG - Intronic
923783021 1:237042487-237042509 CTCGGGAGCCGGCCCCGGCGAGG + Exonic
924436877 1:244049447-244049469 CCCGGGGGAGGGGGCCGGCGGGG + Intronic
1066406863 10:35126929-35126951 CCCGGGAGGCCGTCCCGGCGTGG + Intronic
1067830879 10:49610475-49610497 CCGGGAAGTCGGGCGCGCCGAGG - Exonic
1068371354 10:56120112-56120134 ACAGGAAGATGGGCCAGGCGTGG - Intergenic
1072651893 10:97302452-97302474 CCCAGAAGACAGGCCTGGCATGG + Intergenic
1072656762 10:97335005-97335027 CCCAGGAGGCGGGCCCGGAGTGG - Intergenic
1076905254 10:133358010-133358032 CCCGGCAGACGGGGCGGGCGGGG + Exonic
1077336267 11:2006093-2006115 CCTGGAAGATGGGCACGGCTGGG - Intergenic
1077524771 11:3057448-3057470 CCCGGAAGACGGGCCCGGCGTGG - Intronic
1078545002 11:12240874-12240896 CCCGCAAGCCGGGCCCAGCTGGG - Intronic
1084030913 11:66480157-66480179 CCCGGCAGACGGGACTGACGAGG - Exonic
1085022493 11:73218271-73218293 CCCCGAAGCCGGGCCAGGCAGGG - Intergenic
1090506507 11:127320823-127320845 CCAGGAAGAGGGGCCCTGCAGGG - Intergenic
1202819251 11_KI270721v1_random:61275-61297 CCTGGAAGATGGGCACGGCTGGG - Intergenic
1091795216 12:3294202-3294224 CCTTGAAGAGGGGCCCGGAGTGG + Intergenic
1094041808 12:26126531-26126553 CCCGGAACCCGTGCCCGGCGGGG - Intronic
1096180729 12:49549179-49549201 CCGGGAAGACGCGCGCGGCCGGG - Intronic
1096191587 12:49623494-49623516 CCGGGAGGGCGGGGCCGGCGGGG - Exonic
1096757253 12:53810167-53810189 ACTGGAAGACGGGCCTGGAGAGG + Intergenic
1100483615 12:95003685-95003707 CCCGGGAGGCGGGGCCAGCGAGG - Exonic
1101807851 12:108080567-108080589 CATGGGAGACGGGCCCTGCGAGG + Intergenic
1104857470 12:131908830-131908852 GCAGGCAGGCGGGCCCGGCGGGG + Intronic
1108688993 13:52846054-52846076 CCGGGAAGAGCGGCCCGGGGCGG - Exonic
1113254786 13:108495501-108495523 CCCGGAGGGCTGCCCCGGCGGGG + Intergenic
1114467077 14:22930722-22930744 GCCGGAAAACCGGCCGGGCGCGG + Intergenic
1118336072 14:64854566-64854588 TCCGGAAAACTGGCCGGGCGCGG - Intronic
1119004162 14:70908434-70908456 CCCGGACGAGGGCCGCGGCGGGG - Intronic
1119753519 14:77098082-77098104 GCCGGAAGACCAGGCCGGCGCGG - Exonic
1121683148 14:95811019-95811041 CCCTGAAGACAGGCCGGGCAGGG + Intergenic
1122027723 14:98889656-98889678 CCTGGAAGACTGGCCTGGCTGGG + Intergenic
1122240742 14:100365287-100365309 GTCGGAAGTCGGGCCGGGCGTGG + Intronic
1122593196 14:102870455-102870477 GCCGGGCGACGGGCCGGGCGAGG - Intronic
1122602719 14:102929545-102929567 CCAGCAAGCAGGGCCCGGCGGGG - Intronic
1124248824 15:28094692-28094714 CCCCGAACTCGGGCCCTGCGAGG + Intronic
1126406886 15:48331433-48331455 CCCTGAAGACGCGCCCGTCCTGG - Exonic
1126829822 15:52590076-52590098 CCCAGAAGAAGGGCCGGGCATGG - Intronic
1131171950 15:90185024-90185046 CCAGGAAGAGCGGCCCCGCGGGG + Intronic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1133033880 16:3024058-3024080 CGCGGAAGACGGGCGGCGCGTGG + Exonic
1133232104 16:4371793-4371815 CCCGGGGGGCGGGCCCGCCGCGG - Intronic
1135323487 16:21512041-21512063 CCCTGCAGACGGGCCAGGCAAGG + Intergenic
1136469998 16:30473717-30473739 TCCGAAAGACTGGCCCGGTGGGG + Intronic
1137426382 16:48384856-48384878 CCCGGGAGGCGGGCCCGGCCGGG - Intronic
1140664046 16:77212619-77212641 CCCCGAGGTCGGGGCCGGCGAGG + Exonic
1141531317 16:84648689-84648711 CCAGGAAGCCGCGCCCGGCCGGG + Intronic
1141665395 16:85462964-85462986 GGCAGAAGACGGGCCCGGAGGGG - Intergenic
1142035688 16:87861125-87861147 CCCTGCAGACGGGCCAGGCAAGG + Intronic
1142060683 16:88027345-88027367 GCAGGAAGACGGGGCCGGCCTGG + Intronic
1142124689 16:88404345-88404367 CCCGGCAGACTGGCCCTGGGCGG + Intergenic
1142299649 16:89248867-89248889 TCCCGAAGACGGGTCCTGCGTGG - Intergenic
1142467377 17:144037-144059 GCTGGAAGACGGGCCCGTCGGGG + Intergenic
1142553010 17:752418-752440 CCCGGAAGAGGGGCCGGGCAGGG - Intronic
1142764066 17:2056069-2056091 CGCGAAGGCCGGGCCCGGCGCGG - Intronic
1149430816 17:56594472-56594494 CCCCGAGGACCGGCCCGGCGGGG + Exonic
1151903731 17:77034543-77034565 CCCGGAAGAGGGGCCAGCTGGGG - Intergenic
1157766098 18:50298616-50298638 CCCAGAAGTCGGGCCCTGCGTGG + Intergenic
1158954283 18:62524072-62524094 CGCGGAGGACGAGCGCGGCGAGG + Exonic
1160860403 19:1235131-1235153 CCCGGAAGTCGGGGTCTGCGTGG + Exonic
1160973071 19:1778509-1778531 GCCGGAGCACGGGCCTGGCGGGG + Exonic
1161084569 19:2328856-2328878 CCCCCAAGACGGGCCGAGCGGGG - Intronic
1161302205 19:3548122-3548144 CCCGGAACACGGGCACGTCCTGG + Exonic
1163262127 19:16197755-16197777 CCCGGAAGTAAGGCCCGGTGGGG - Intronic
1163551158 19:17967118-17967140 CCCAGTCCACGGGCCCGGCGGGG - Intronic
1163554056 19:17982686-17982708 CAGGGAGAACGGGCCCGGCGGGG + Intronic
1165448222 19:35868478-35868500 CCAGGAAGGCGGGGCCGGCGCGG + Exonic
1165819102 19:38663316-38663338 CTCTGAAGAGGGGCCCAGCGAGG - Intronic
1167200463 19:48061764-48061786 CCAGGAAGAGGGGCCCGGGAAGG + Intronic
1167258004 19:48442688-48442710 CCCGGGAGCCGGCCGCGGCGCGG - Exonic
1168145504 19:54418268-54418290 CCCGGAAGACAGGCAGGCCGCGG - Intronic
1168341062 19:55623322-55623344 CCTGGAGGATGGGCCGGGCGCGG - Intronic
1168401819 19:56089566-56089588 CCCTGAAGACGTGCCCGCCAGGG + Intronic
927714037 2:25341410-25341432 CCCGGAAGGCGGGGGCGGCCCGG + Intronic
928637039 2:33257477-33257499 CCGGGAACACGGGCCAGGAGTGG + Exonic
932660015 2:73643727-73643749 CCTAGATGACGGGCCCAGCGTGG - Intergenic
932666585 2:73703384-73703406 CCTAGATGACGGGCCCAGCGTGG - Intergenic
934795353 2:97094919-97094941 CCCGGAGGGCGGGCCCAGTGCGG + Intergenic
941384923 2:164841346-164841368 CCCGGGAGGCGGGCCGGCCGGGG - Exonic
944611174 2:201410005-201410027 ACCTGAAGAGGGGCCGGGCGCGG + Intronic
945955469 2:216082181-216082203 CCCGGCAGGCGGGCGCAGCGAGG - Exonic
946019982 2:216634108-216634130 CGCGGAAGTCAGGCCCGGGGAGG + Intronic
946279666 2:218657718-218657740 TCGGGAAGCCAGGCCCGGCGCGG - Intronic
948699124 2:239749527-239749549 CCAGAAAGACGGGCCCTGCACGG - Intergenic
1169849579 20:10034989-10035011 CCCGGCAGCCGCGCCCTGCGTGG + Intronic
1169859026 20:10132451-10132473 CCAGGAAGACGGGCTCAGCACGG + Intergenic
1170828688 20:19820643-19820665 CCAGGAAGACTGGCCTGGCCTGG - Intergenic
1174444032 20:50578542-50578564 CCCGGAGCACGGGCCCGTTGTGG + Exonic
1176221067 20:63969648-63969670 GCAGGAAGACGGCGCCGGCGCGG + Intronic
1176549096 21:8213791-8213813 GTCGGGAGACGGGCCCGGCGAGG - Intergenic
1176556989 21:8258012-8258034 GTCGGGAGACGGGCCCGGCGAGG - Intergenic
1176568028 21:8396829-8396851 GTCGGGAGACGGGCCCGGCGAGG - Intergenic
1176575931 21:8441049-8441071 GTCGGGAGACGGGCCCGGCGAGG - Intergenic
1181761237 22:25060036-25060058 CCCGGAAGCCAGGCCAGGCAGGG + Intronic
1184618946 22:45659391-45659413 CCCTGCAGACAGGCCGGGCGCGG - Intergenic
1184759402 22:46536464-46536486 CCGGCGCGACGGGCCCGGCGGGG - Exonic
1185289093 22:50015107-50015129 CCCGTGAGTCGGGACCGGCGCGG - Exonic
1185398372 22:50603863-50603885 CACGGACACCGGGCCCGGCGGGG + Exonic
1203253981 22_KI270733v1_random:130107-130129 GTCGGGAGACGGGCCCGGCGAGG - Intergenic
1203262037 22_KI270733v1_random:175186-175208 GTCGGGAGACGGGCCCGGCGAGG - Intergenic
950408538 3:12819592-12819614 CCAGGAAGAGGGGCCCAGCCAGG + Intronic
952241284 3:31533147-31533169 CGCCGAAGCCGGCCCCGGCGGGG + Exonic
953464400 3:43106048-43106070 CCCGGCGGGCGAGCCCGGCGCGG + Exonic
955387738 3:58492440-58492462 CCCGGACGAGGGGCGCGCCGCGG - Intronic
959067827 3:101676346-101676368 CCCGGAGGCCGGGCCAGCCGCGG - Intronic
968230728 3:197003267-197003289 CGCGAAGGCCGGGCCCGGCGTGG - Exonic
968551411 4:1225596-1225618 CCCGGAGGCTGGGCCCGGCCCGG - Intronic
969506592 4:7591782-7591804 CCCTGACGACAGGCCCGCCGGGG - Intronic
975689547 4:76950138-76950160 CCCAGAAGAGGGGCGCGACGAGG - Intronic
976595654 4:86892502-86892524 CCCGGGAGACGCGCCCCGCGGGG + Intronic
984992579 4:185396073-185396095 CCCGGGAGGAGAGCCCGGCGTGG + Intronic
988481429 5:31634662-31634684 CCAGCAAGACAGGCCTGGCGTGG - Intergenic
991298189 5:65103095-65103117 CCCGGAGGCGGGGCGCGGCGGGG - Intergenic
1001496205 5:172188882-172188904 CCGGGAAGCCGGGCCCTGCAGGG - Intergenic
1002196893 5:177506026-177506048 CCCGGGAGGCGGGCTGGGCGCGG - Intronic
1002541164 5:179907523-179907545 CCCGGGAGCCGGGCGCGGAGGGG - Intronic
1003074407 6:2971150-2971172 CACGGAAGAGGCGGCCGGCGCGG - Intronic
1006224109 6:32521965-32521987 CCTGGAAGACAGGCGCGCCGCGG - Exonic
1018910674 6:168099584-168099606 CCCGAAAGCCAGGCCAGGCGGGG - Intergenic
1031052001 7:116953931-116953953 CCCGCAAGGCGGGCCGGGCCGGG + Exonic
1034243116 7:149624623-149624645 ACCGGGAGGCGGGCCCTGCGTGG - Intergenic
1035774166 8:2174419-2174441 CCTGGAAGAGGGGCCCAGGGTGG + Intergenic
1035971704 8:4256682-4256704 CCCAGCAGATGGGCCGGGCGTGG + Intronic
1036241283 8:7083124-7083146 CCAGGAGGTCGGGCCCCGCGGGG - Intergenic
1037305236 8:17497288-17497310 CCCGGACGCTGGGGCCGGCGGGG + Intronic
1037827024 8:22165571-22165593 CCCCGGCGACGGGCCAGGCGGGG + Intronic
1038828463 8:31032890-31032912 CGGGGGAGCCGGGCCCGGCGTGG - Exonic
1044595139 8:93952392-93952414 CCATGAAGACAGGCCAGGCGTGG - Intergenic
1048986878 8:139739483-139739505 CCCGGGAGACGGGCTCTGGGAGG - Intronic
1049212256 8:141392172-141392194 CCCCGAAGCCGTGCCCGGAGCGG - Intronic
1049784403 8:144443726-144443748 ACCGGAGGACTGGCCCGGGGCGG + Intronic
1054905877 9:70413441-70413463 CTCGGACGACGAGCGCGGCGCGG + Exonic
1055945625 9:81689108-81689130 CTCGGAAGAAGGGTCCGGAGCGG - Exonic
1061134241 9:128724114-128724136 CCCGGAAGAAGCGCCCAGAGGGG + Intronic
1062491703 9:136808077-136808099 CCCGGAGGCCGGAGCCGGCGCGG - Exonic
1203470382 Un_GL000220v1:113251-113273 GTCGGGAGACGGGCCCGGCGAGG - Intergenic
1203478203 Un_GL000220v1:157223-157245 GTCGGGAGACGGGCCCGGCGAGG - Intergenic
1185736565 X:2500685-2500707 CCCGGAAGTGGGGCTGGGCGGGG - Intronic
1187281435 X:17860925-17860947 CCCGGAGGCCGGGGCCGGCTGGG - Intronic
1188452208 X:30319536-30319558 CCTGGAAGGCGGGCGGGGCGGGG - Intergenic
1190024720 X:46912728-46912750 CGCGGAGGCCGGACCCGGCGCGG + Intronic
1191830108 X:65407188-65407210 CTCGGAAGAAGGGTCCGGAGCGG + Intronic
1193295756 X:79829693-79829715 CCCGGAAGACATGCCTGGTGAGG + Intergenic