ID: 1077527229

View in Genome Browser
Species Human (GRCh38)
Location 11:3074505-3074527
Sequence ACATCTTGTCACTGCATTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077527229_1077527234 8 Left 1077527229 11:3074505-3074527 CCCTAAATGCAGTGACAAGATGT No data
Right 1077527234 11:3074536-3074558 GAAGAGTGACACAGGAAGATGGG No data
1077527229_1077527237 27 Left 1077527229 11:3074505-3074527 CCCTAAATGCAGTGACAAGATGT No data
Right 1077527237 11:3074555-3074577 TGGGACACACAGAAGGGAGAAGG No data
1077527229_1077527233 7 Left 1077527229 11:3074505-3074527 CCCTAAATGCAGTGACAAGATGT No data
Right 1077527233 11:3074535-3074557 AGAAGAGTGACACAGGAAGATGG No data
1077527229_1077527235 20 Left 1077527229 11:3074505-3074527 CCCTAAATGCAGTGACAAGATGT No data
Right 1077527235 11:3074548-3074570 AGGAAGATGGGACACACAGAAGG No data
1077527229_1077527232 0 Left 1077527229 11:3074505-3074527 CCCTAAATGCAGTGACAAGATGT No data
Right 1077527232 11:3074528-3074550 CCTTATAAGAAGAGTGACACAGG No data
1077527229_1077527236 21 Left 1077527229 11:3074505-3074527 CCCTAAATGCAGTGACAAGATGT No data
Right 1077527236 11:3074549-3074571 GGAAGATGGGACACACAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077527229 Original CRISPR ACATCTTGTCACTGCATTTA GGG (reversed) Intergenic
No off target data available for this crispr