ID: 1077527230

View in Genome Browser
Species Human (GRCh38)
Location 11:3074506-3074528
Sequence GACATCTTGTCACTGCATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077527230_1077527236 20 Left 1077527230 11:3074506-3074528 CCTAAATGCAGTGACAAGATGTC No data
Right 1077527236 11:3074549-3074571 GGAAGATGGGACACACAGAAGGG No data
1077527230_1077527235 19 Left 1077527230 11:3074506-3074528 CCTAAATGCAGTGACAAGATGTC No data
Right 1077527235 11:3074548-3074570 AGGAAGATGGGACACACAGAAGG No data
1077527230_1077527233 6 Left 1077527230 11:3074506-3074528 CCTAAATGCAGTGACAAGATGTC No data
Right 1077527233 11:3074535-3074557 AGAAGAGTGACACAGGAAGATGG No data
1077527230_1077527234 7 Left 1077527230 11:3074506-3074528 CCTAAATGCAGTGACAAGATGTC No data
Right 1077527234 11:3074536-3074558 GAAGAGTGACACAGGAAGATGGG No data
1077527230_1077527237 26 Left 1077527230 11:3074506-3074528 CCTAAATGCAGTGACAAGATGTC No data
Right 1077527237 11:3074555-3074577 TGGGACACACAGAAGGGAGAAGG No data
1077527230_1077527232 -1 Left 1077527230 11:3074506-3074528 CCTAAATGCAGTGACAAGATGTC No data
Right 1077527232 11:3074528-3074550 CCTTATAAGAAGAGTGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077527230 Original CRISPR GACATCTTGTCACTGCATTT AGG (reversed) Intergenic
No off target data available for this crispr