ID: 1077527231

View in Genome Browser
Species Human (GRCh38)
Location 11:3074528-3074550
Sequence CCTGTGTCACTCTTCTTATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077527231_1077527236 -2 Left 1077527231 11:3074528-3074550 CCTTATAAGAAGAGTGACACAGG No data
Right 1077527236 11:3074549-3074571 GGAAGATGGGACACACAGAAGGG No data
1077527231_1077527239 18 Left 1077527231 11:3074528-3074550 CCTTATAAGAAGAGTGACACAGG No data
Right 1077527239 11:3074569-3074591 GGGAGAAGGTCATGTGAGGATGG No data
1077527231_1077527241 24 Left 1077527231 11:3074528-3074550 CCTTATAAGAAGAGTGACACAGG No data
Right 1077527241 11:3074575-3074597 AGGTCATGTGAGGATGGAGGTGG No data
1077527231_1077527240 21 Left 1077527231 11:3074528-3074550 CCTTATAAGAAGAGTGACACAGG No data
Right 1077527240 11:3074572-3074594 AGAAGGTCATGTGAGGATGGAGG No data
1077527231_1077527237 4 Left 1077527231 11:3074528-3074550 CCTTATAAGAAGAGTGACACAGG No data
Right 1077527237 11:3074555-3074577 TGGGACACACAGAAGGGAGAAGG No data
1077527231_1077527238 14 Left 1077527231 11:3074528-3074550 CCTTATAAGAAGAGTGACACAGG No data
Right 1077527238 11:3074565-3074587 AGAAGGGAGAAGGTCATGTGAGG No data
1077527231_1077527235 -3 Left 1077527231 11:3074528-3074550 CCTTATAAGAAGAGTGACACAGG No data
Right 1077527235 11:3074548-3074570 AGGAAGATGGGACACACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077527231 Original CRISPR CCTGTGTCACTCTTCTTATA AGG (reversed) Intergenic
No off target data available for this crispr