ID: 1077527232

View in Genome Browser
Species Human (GRCh38)
Location 11:3074528-3074550
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077527229_1077527232 0 Left 1077527229 11:3074505-3074527 CCCTAAATGCAGTGACAAGATGT No data
Right 1077527232 11:3074528-3074550 CCTTATAAGAAGAGTGACACAGG No data
1077527230_1077527232 -1 Left 1077527230 11:3074506-3074528 CCTAAATGCAGTGACAAGATGTC No data
Right 1077527232 11:3074528-3074550 CCTTATAAGAAGAGTGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077527232 Original CRISPR CCTTATAAGAAGAGTGACAC AGG Intergenic
No off target data available for this crispr