ID: 1077527233

View in Genome Browser
Species Human (GRCh38)
Location 11:3074535-3074557
Sequence AGAAGAGTGACACAGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077527229_1077527233 7 Left 1077527229 11:3074505-3074527 CCCTAAATGCAGTGACAAGATGT No data
Right 1077527233 11:3074535-3074557 AGAAGAGTGACACAGGAAGATGG No data
1077527230_1077527233 6 Left 1077527230 11:3074506-3074528 CCTAAATGCAGTGACAAGATGTC No data
Right 1077527233 11:3074535-3074557 AGAAGAGTGACACAGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077527233 Original CRISPR AGAAGAGTGACACAGGAAGA TGG Intergenic
No off target data available for this crispr