ID: 1077527234

View in Genome Browser
Species Human (GRCh38)
Location 11:3074536-3074558
Sequence GAAGAGTGACACAGGAAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077527230_1077527234 7 Left 1077527230 11:3074506-3074528 CCTAAATGCAGTGACAAGATGTC No data
Right 1077527234 11:3074536-3074558 GAAGAGTGACACAGGAAGATGGG No data
1077527229_1077527234 8 Left 1077527229 11:3074505-3074527 CCCTAAATGCAGTGACAAGATGT No data
Right 1077527234 11:3074536-3074558 GAAGAGTGACACAGGAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077527234 Original CRISPR GAAGAGTGACACAGGAAGAT GGG Intergenic
No off target data available for this crispr