ID: 1077527235

View in Genome Browser
Species Human (GRCh38)
Location 11:3074548-3074570
Sequence AGGAAGATGGGACACACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077527230_1077527235 19 Left 1077527230 11:3074506-3074528 CCTAAATGCAGTGACAAGATGTC No data
Right 1077527235 11:3074548-3074570 AGGAAGATGGGACACACAGAAGG No data
1077527229_1077527235 20 Left 1077527229 11:3074505-3074527 CCCTAAATGCAGTGACAAGATGT No data
Right 1077527235 11:3074548-3074570 AGGAAGATGGGACACACAGAAGG No data
1077527231_1077527235 -3 Left 1077527231 11:3074528-3074550 CCTTATAAGAAGAGTGACACAGG No data
Right 1077527235 11:3074548-3074570 AGGAAGATGGGACACACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077527235 Original CRISPR AGGAAGATGGGACACACAGA AGG Intergenic
No off target data available for this crispr