ID: 1077527240

View in Genome Browser
Species Human (GRCh38)
Location 11:3074572-3074594
Sequence AGAAGGTCATGTGAGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077527231_1077527240 21 Left 1077527231 11:3074528-3074550 CCTTATAAGAAGAGTGACACAGG No data
Right 1077527240 11:3074572-3074594 AGAAGGTCATGTGAGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077527240 Original CRISPR AGAAGGTCATGTGAGGATGG AGG Intergenic
No off target data available for this crispr