ID: 1077527241

View in Genome Browser
Species Human (GRCh38)
Location 11:3074575-3074597
Sequence AGGTCATGTGAGGATGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077527231_1077527241 24 Left 1077527231 11:3074528-3074550 CCTTATAAGAAGAGTGACACAGG No data
Right 1077527241 11:3074575-3074597 AGGTCATGTGAGGATGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077527241 Original CRISPR AGGTCATGTGAGGATGGAGG TGG Intergenic
No off target data available for this crispr