ID: 1077528313

View in Genome Browser
Species Human (GRCh38)
Location 11:3082274-3082296
Sequence TAAAATACCCAAAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077528313_1077528317 0 Left 1077528313 11:3082274-3082296 CCCTCCTCCTTTTGGGTATTTTA No data
Right 1077528317 11:3082297-3082319 TACCCAAAAGACATGAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077528313 Original CRISPR TAAAATACCCAAAAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr