ID: 1077530533

View in Genome Browser
Species Human (GRCh38)
Location 11:3092759-3092781
Sequence GGGGACAGGCTGAAGGTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 751
Summary {0: 1, 1: 1, 2: 5, 3: 86, 4: 658}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077530526_1077530533 -7 Left 1077530526 11:3092743-3092765 CCCACCGACTCCTCCAGGGGACA 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1077530533 11:3092759-3092781 GGGGACAGGCTGAAGGTGAGAGG 0: 1
1: 1
2: 5
3: 86
4: 658
1077530524_1077530533 -5 Left 1077530524 11:3092741-3092763 CCCCCACCGACTCCTCCAGGGGA 0: 1
1: 0
2: 1
3: 17
4: 250
Right 1077530533 11:3092759-3092781 GGGGACAGGCTGAAGGTGAGAGG 0: 1
1: 1
2: 5
3: 86
4: 658
1077530525_1077530533 -6 Left 1077530525 11:3092742-3092764 CCCCACCGACTCCTCCAGGGGAC 0: 1
1: 0
2: 0
3: 15
4: 176
Right 1077530533 11:3092759-3092781 GGGGACAGGCTGAAGGTGAGAGG 0: 1
1: 1
2: 5
3: 86
4: 658
1077530520_1077530533 -2 Left 1077530520 11:3092738-3092760 CCTCCCCCACCGACTCCTCCAGG 0: 1
1: 0
2: 4
3: 52
4: 675
Right 1077530533 11:3092759-3092781 GGGGACAGGCTGAAGGTGAGAGG 0: 1
1: 1
2: 5
3: 86
4: 658
1077530519_1077530533 -1 Left 1077530519 11:3092737-3092759 CCCTCCCCCACCGACTCCTCCAG 0: 1
1: 0
2: 9
3: 69
4: 677
Right 1077530533 11:3092759-3092781 GGGGACAGGCTGAAGGTGAGAGG 0: 1
1: 1
2: 5
3: 86
4: 658
1077530527_1077530533 -8 Left 1077530527 11:3092744-3092766 CCACCGACTCCTCCAGGGGACAG 0: 1
1: 0
2: 0
3: 16
4: 197
Right 1077530533 11:3092759-3092781 GGGGACAGGCTGAAGGTGAGAGG 0: 1
1: 1
2: 5
3: 86
4: 658

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077530533 Original CRISPR GGGGACAGGCTGAAGGTGAG AGG Intronic
900088244 1:908718-908740 GGGGACAGGTGGGAGGGGAGAGG + Intergenic
900140037 1:1135971-1135993 TGGGCAAGGCTGAGGGTGAGGGG + Intergenic
900330440 1:2131684-2131706 GGGGACAGCCTGCAGTTGGGTGG - Intronic
900345459 1:2208331-2208353 GGAGACAGGGTAAAGTTGAGAGG - Intronic
900545114 1:3224452-3224474 GGGCACATGCGGAAGGGGAGAGG - Intronic
900598749 1:3494116-3494138 GGGGACAGGCTGAAGGACGCCGG + Exonic
900603206 1:3511969-3511991 GGCAACAGGCTGAAGGTGCCCGG - Intronic
901217470 1:7562848-7562870 GTTGACAGGCTGCAGGTGAGTGG - Intronic
901321407 1:8342457-8342479 GGGGACAGGAAGAAGGTTAGCGG - Intronic
901342788 1:8510368-8510390 GGTGGCAGGCTGAAAGGGAGGGG + Intronic
901473275 1:9472425-9472447 GGGGACAGGGGGCAGGTTAGGGG - Intergenic
901647279 1:10723496-10723518 GGGGTGAGGCAGCAGGTGAGAGG - Intronic
901791245 1:11654691-11654713 TGGGTCAGGCCGAGGGTGAGGGG + Intronic
902248542 1:15138121-15138143 GGGGAGAGGTAGAAGATGAGTGG - Intergenic
902388506 1:16089346-16089368 GGGGCCAGGCTGGAGGCTAGAGG + Intergenic
902768871 1:18634268-18634290 GGGGAGATGCAGAAGGAGAGAGG - Intronic
903949427 1:26986976-26986998 AGGGAGAGGCTGAAAGGGAGAGG + Intergenic
903971605 1:27122574-27122596 AGGGCCAGGCTGAAGGTCAGGGG - Intronic
904041233 1:27586346-27586368 TGAGACAGGCAGAAGGGGAGAGG + Intronic
904901693 1:33862682-33862704 GGGGACAAGCTGTAGTTGTGTGG - Intronic
904937321 1:34140914-34140936 GGGGACAGGTTGTAGAGGAGGGG - Intronic
906241443 1:44244783-44244805 GGGCTCAGGCTGTAGGGGAGGGG - Intronic
907048863 1:51316384-51316406 GGGGACAGGCTGGAGGAGGGAGG - Intronic
907431276 1:54413427-54413449 GGGCACAGGCTGAAGGGCAGAGG + Intronic
907490942 1:54808502-54808524 GGGCACTGGCCGAGGGTGAGAGG + Intronic
907973259 1:59405704-59405726 GGGGGTAGGCTAAAGGTGGGAGG - Intronic
908082644 1:60597860-60597882 GGGGTCAAGCTGAAGGGCAGGGG - Intergenic
908457251 1:64315783-64315805 CAGGACAAGCTGAAGTTGAGGGG + Intergenic
909684926 1:78337137-78337159 GGGGCCTGGCAGGAGGTGAGGGG + Intronic
909761910 1:79299445-79299467 GGGGGCAGGCAGAAGTGGAGTGG - Intergenic
909893307 1:81035284-81035306 GGGGGCAGGGAGAAGGAGAGTGG + Intergenic
910555895 1:88532389-88532411 GGACACTGGCTGAAGTTGAGAGG - Intergenic
910557026 1:88545452-88545474 GGGTAAAGGCTGAGAGTGAGGGG + Intergenic
910626553 1:89313775-89313797 GGGTACAGGCTGAAGATGAATGG + Intergenic
911038564 1:93574556-93574578 TGGGACAGGCTGAGGGTGACAGG - Intronic
911504067 1:98726845-98726867 GGGCACAGGATGAATATGAGAGG - Intronic
911724016 1:101222422-101222444 TGGGACAGGATGAAGGAGAGAGG - Intergenic
912135645 1:106657418-106657440 GGGAAATGTCTGAAGGTGAGAGG - Intergenic
912473074 1:109918953-109918975 AGGGGCAGCCTGAAGGTGGGAGG + Intronic
913030496 1:114897721-114897743 GGGTACAGACTGAAGATGAATGG + Intronic
913103500 1:115591964-115591986 GGGTACAGACTGAAGATGAACGG - Intergenic
914825201 1:151134455-151134477 AGGGACAGGGTGAAGATGGGGGG + Intronic
915214404 1:154330223-154330245 GTGGTCAGGCTGCTGGTGAGAGG + Intronic
915296097 1:154922967-154922989 TAGCACAGGCTGAAGGAGAGAGG - Intergenic
915348579 1:155210849-155210871 GAGCACAGGCTGAAGGAGAGTGG + Intronic
915351771 1:155231477-155231499 GAGCACAGGCTGAAGGAGACTGG + Intergenic
915489623 1:156243939-156243961 GGGGACTGGCAGAGTGTGAGAGG - Exonic
915622240 1:157092838-157092860 TGGGACAGGGTGCGGGTGAGAGG - Exonic
915656526 1:157365436-157365458 GGGTACAGACTGAAGATGAATGG + Intergenic
915672760 1:157504135-157504157 GGGTACAGACTGAAGATGAATGG - Intergenic
915748168 1:158181148-158181170 GGGGAAGCGCTGAAGGTGGGTGG + Exonic
915946184 1:160153338-160153360 GTGGCCAGGCAGAGGGTGAGGGG - Intronic
919128131 1:193421648-193421670 GGAGGCAGGCTGGAAGTGAGAGG - Intergenic
919790649 1:201288744-201288766 GGGGACAGGATGGGCGTGAGGGG - Intronic
919849299 1:201661762-201661784 GGCTACAGGCTGAGGGTGAGCGG - Intronic
919879345 1:201891766-201891788 AGAGACAGGATGAGGGTGAGTGG - Intronic
920304555 1:205010206-205010228 AGGGAGAGGCTGAAGATGGGTGG + Intronic
920446968 1:206024986-206025008 AGAGATAGGCTGATGGTGAGGGG - Intergenic
920699977 1:208210454-208210476 GGGGACAGGCTGGAGGGAAGCGG + Exonic
920700701 1:208216307-208216329 GGGGAGAGGCAGTAGCTGAGAGG - Intronic
921364388 1:214359978-214360000 ATGGACATGGTGAAGGTGAGGGG - Intronic
921734225 1:218608619-218608641 TGAGAGAGGCTGAATGTGAGTGG + Intergenic
923053183 1:230403379-230403401 GGGGACAAGTGGAGGGTGAGAGG - Intronic
923304537 1:232675919-232675941 GGGGACAGGGTGAGGGGGTGTGG + Intergenic
924159491 1:241216180-241216202 GGGAACAGGCTGAACCTGGGAGG + Intronic
924737659 1:246772892-246772914 TGGGACAGGAAGAAGGTGACAGG - Intergenic
1062817136 10:508992-509014 GAGGACAGGCTGAAGTTAAAAGG - Intronic
1062948739 10:1479638-1479660 GGGGAGAGGCTGAAGAGGGGTGG + Intronic
1063849428 10:10168173-10168195 GATGAAAGGCTGAAGATGAGGGG - Intergenic
1064151489 10:12869385-12869407 GGGGACTGGTGGAAGGTGATTGG - Intergenic
1065151414 10:22826641-22826663 GGGTACAGACTGAAGATGAATGG + Intergenic
1065318377 10:24486182-24486204 GAGAACAGGCTGAAGGTGGCAGG - Intronic
1065421281 10:25547179-25547201 GGGGAGAGACTGAAGGCGAGAGG - Intronic
1065918739 10:30373013-30373035 GCAGACAGGCTGAAGGTTAATGG + Intronic
1067229294 10:44395614-44395636 GGGGACAGGGGGAAGGGAAGAGG - Intergenic
1069018876 10:63464571-63464593 AGGGACAGCTTGAAGGTAAGGGG - Intronic
1070199134 10:74186235-74186257 GGGGAAAGGCGGAAGGGGAAGGG - Intronic
1070389710 10:75958845-75958867 GGTGGAAGGCTGAAGGTGAAAGG + Intronic
1070620857 10:78009667-78009689 GGTGACAGGCTGAGGGGGGGAGG + Exonic
1070731261 10:78830136-78830158 GGGGAATGGCTGGAGGGGAGTGG - Intergenic
1071085480 10:81863879-81863901 GGGGTTAGGGTGGAGGTGAGAGG - Intergenic
1071562098 10:86652660-86652682 GGGGGCAGGGTGAGGCTGAGGGG - Intergenic
1071563504 10:86660082-86660104 GGGAAGAGGCTGAAGGTGTGGGG + Intronic
1072621721 10:97084109-97084131 GGAGACAGGCAGAGGGTGGGTGG + Intronic
1072879307 10:99208784-99208806 GGACACAGGCTGAAAATGAGGGG + Intronic
1073078141 10:100837371-100837393 GGGCACAGGCTGAAGCTTCGTGG - Intergenic
1073173640 10:101535429-101535451 AGGGACAGGCTGGTAGTGAGTGG + Exonic
1073456248 10:103638344-103638366 GTGGGCAGGCTGGAGCTGAGTGG - Intronic
1073748305 10:106494878-106494900 GGGGACATGGAGGAGGTGAGAGG - Intergenic
1075587519 10:123668206-123668228 GGGGACAGGCTGGAGGTGTCAGG + Intronic
1075627308 10:123972460-123972482 GGGGAGAGGATGTAGGGGAGGGG + Intergenic
1075627346 10:123972550-123972572 GGGGAGAGGATGCAGGGGAGGGG + Intergenic
1075738712 10:124680238-124680260 GGGGAGAGCCTGAAGGGGTGTGG - Intronic
1075819817 10:125297229-125297251 GAGGAGAGGCTGAAGGTGCTGGG - Intergenic
1075908614 10:126104564-126104586 GAGGACAGTCTGGAGGTGAAGGG + Intronic
1076282831 10:129264064-129264086 GGGGACGGGCTCAGGATGAGTGG - Intergenic
1076920993 10:133454593-133454615 CAGGAGAGGCTGGAGGTGAGAGG + Intergenic
1076944769 10:133638224-133638246 GGGGACAGCCGGGAGGAGAGAGG - Intergenic
1077028431 11:452006-452028 GAGGACAGCCTGAAGGGGTGTGG - Intronic
1077059936 11:613633-613655 GGGGACAGGCTGTGAGTGACGGG + Intronic
1077146945 11:1050639-1050661 GGGGACAGGCCCGAGGTGCGGGG + Intergenic
1077164689 11:1129754-1129776 GGGGACAGGCCCAGGGTGGGAGG - Intergenic
1077245511 11:1535360-1535382 GAAGACAGACTGCAGGTGAGTGG - Intergenic
1077287329 11:1773343-1773365 AGAGACAGACTGAAGGTCAGGGG - Intergenic
1077530533 11:3092759-3092781 GGGGACAGGCTGAAGGTGAGAGG + Intronic
1077581254 11:3418671-3418693 GGGGACAGGATGGAGGGGAGGGG + Intergenic
1077609529 11:3635899-3635921 GGGAAAGGGCTGACGGTGAGAGG - Intergenic
1078088007 11:8246080-8246102 GGGGACAGGTGGGAGGTGATTGG - Intronic
1078132592 11:8624992-8625014 GGGCACAGTCTGTAGGTGACTGG + Exonic
1080252394 11:30248400-30248422 TGGGACAGGTTGATGGTTAGTGG + Intergenic
1081489508 11:43556632-43556654 GGGGGGATGCTGAAGGAGAGAGG - Intronic
1081753387 11:45527929-45527951 GAAGACAGGGTGATGGTGAGGGG - Intergenic
1083347458 11:62003488-62003510 GGGAACAGGCTGAAGGAGCTAGG + Intergenic
1083769138 11:64856626-64856648 GGGCACAGGCTCAGGCTGAGCGG - Intronic
1083902505 11:65650465-65650487 GAGGACCTGCAGAAGGTGAGGGG + Exonic
1084188779 11:67489441-67489463 ATGGAGATGCTGAAGGTGAGGGG + Exonic
1084473619 11:69376815-69376837 GGCGAGAGGGTGAAGGCGAGAGG - Intergenic
1084473622 11:69376829-69376851 GGCGAGAGGGTGAAGGCGAGAGG - Intergenic
1084735690 11:71103851-71103873 GGGGAGAGGGAGAAGGGGAGGGG - Intronic
1084834233 11:71791325-71791347 GGGGACAGGATGGAGGGGAGGGG - Intronic
1085307016 11:75492245-75492267 GGGCACAGGCTGGAGGTAGGAGG - Intronic
1085508232 11:77072165-77072187 GAGGACAGGGTGCAGGGGAGAGG - Intronic
1085519796 11:77131162-77131184 GGGGAAGGGCTGAGGGTCAGAGG - Intronic
1085699017 11:78729743-78729765 AGGGAAAGGCAGAAGGAGAGAGG + Intronic
1086296404 11:85372909-85372931 GGGTACAGACTGAAGGTGAGTGG - Intronic
1086490850 11:87356539-87356561 CGGGGCAGGCTGAAGTTGAGGGG + Intergenic
1086794738 11:91085471-91085493 GGGGCCAGGTGGAAGGTGATTGG + Intergenic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1087016540 11:93559751-93559773 AGGAAAAGACTGAAGGTGAGTGG + Intergenic
1087431759 11:98064903-98064925 GGGTACAGACTGAAGATGAATGG + Intergenic
1088175453 11:107048388-107048410 GGGAGCAGGCTGGAGGGGAGGGG - Intergenic
1089388252 11:118081987-118082009 GGAGATGGGATGAAGGTGAGGGG - Intronic
1089830361 11:121321930-121321952 GGGGATTGGGTGAAGGTGGGAGG + Intergenic
1090076901 11:123585262-123585284 GGGGATGGGCTGGAGGGGAGAGG + Intronic
1091145890 11:133279940-133279962 GGGGAGTGGCTGAAGAAGAGAGG - Intronic
1091268751 11:134290819-134290841 GGGGAGAGGCTGCAGCTGTGGGG - Intronic
1091490660 12:929811-929833 AGGGTCCAGCTGAAGGTGAGGGG - Exonic
1091584864 12:1810386-1810408 GGGGACAGGCTGGAGGACCGGGG - Intronic
1092239128 12:6826840-6826862 AGGAAGAGGCTGAAGGTGGGGGG + Exonic
1092408850 12:8239141-8239163 GGGGACAGGATGGAGGGGAGGGG + Intergenic
1092563154 12:9637505-9637527 GGGTACAGACTGAAGATGAATGG + Intergenic
1092585744 12:9899452-9899474 GGGCACAGACTGAAGTTGAATGG + Intronic
1093429271 12:19065574-19065596 TGGGGGAGGGTGAAGGTGAGTGG - Intergenic
1094494773 12:30982493-30982515 AGGCAGAGGCTGGAGGTGAGAGG - Intronic
1094848486 12:34371931-34371953 GGGGACAAGCTGAAGGTGGCAGG - Intergenic
1096008225 12:48189594-48189616 GGGGACAGTCTAAATGTGAGGGG - Intergenic
1096029337 12:48398094-48398116 GGAGACAGGCTGAGGGAGAATGG - Intergenic
1096234534 12:49917243-49917265 GGAGACAGGAGGAATGTGAGGGG + Intergenic
1096905289 12:54930044-54930066 GGGTACAGACTGAAGATGACTGG + Intergenic
1097158488 12:57029354-57029376 TGGGGCAGGCTGGAGGTGATGGG - Intronic
1097499838 12:60388478-60388500 GGGTACAGACTGAAGATGAATGG + Intergenic
1098153459 12:67572528-67572550 GGAGACAGGCTCAAGGTGGTAGG + Intergenic
1098400427 12:70069447-70069469 GGGGTGGGGCTGAAGGTCAGAGG + Intergenic
1099082836 12:78207884-78207906 GAGGACAGACTGAAGGAGATAGG + Intronic
1099413479 12:82359545-82359567 GGGCAAAAGCTGAAGCTGAGAGG + Intronic
1099534632 12:83828595-83828617 GGGAACAGCCTGAAGATGAATGG + Intergenic
1100088652 12:90942320-90942342 GGGGACAGGCCTAATTTGAGGGG - Intronic
1100258865 12:92912707-92912729 GGGGAAAGGGTGAGGGTGGGAGG - Intronic
1101580481 12:106037695-106037717 GGGGACAGGGGGAAAGGGAGGGG - Intergenic
1101995221 12:109520617-109520639 GGGGACATCCTGAAGGTAATGGG - Intronic
1102027641 12:109722661-109722683 GGGGACAGGCAGCAGGGTAGGGG - Intronic
1102834420 12:116041158-116041180 GGGGCCAGGTAGAAGGTGACTGG + Intronic
1103024438 12:117562251-117562273 GGGGACATGAGGAAGGGGAGGGG + Intronic
1104058778 12:125250464-125250486 GGGGACACGATGAGGGTGAAAGG - Intronic
1104931151 12:132340105-132340127 GGAGTGAAGCTGAAGGTGAGGGG - Intergenic
1104992735 12:132635241-132635263 CGGGCCAGGCTGTGGGTGAGTGG - Intronic
1105333227 13:19437706-19437728 TGGGGCAGGATTAAGGTGAGGGG - Intronic
1105405285 13:20128052-20128074 GCGGTCAGGCTGAAGGAGAGGGG - Intergenic
1105657463 13:22456554-22456576 GGGTTCAGGCTGAAGCTAAGTGG - Intergenic
1105921369 13:24967006-24967028 TGGGGCAGGATTAAGGTGAGGGG - Intergenic
1107015818 13:35706896-35706918 GGGGACAGGCACAAGGGGTGGGG + Intergenic
1107730558 13:43344193-43344215 GCGGACAGCCTGCAGGTGAACGG + Intronic
1108247689 13:48533461-48533483 TGGGGCAGGCTGGAGGAGAGGGG - Intergenic
1108522592 13:51259388-51259410 GGGGAGAGGCAGGAGGTCAGCGG - Intronic
1108626597 13:52234828-52234850 TGGGGCAGGATTAAGGTGAGGGG - Intergenic
1108659473 13:52571662-52571684 TGGGGCAGGATTAAGGTGAGGGG + Intergenic
1109083155 13:57933423-57933445 GGAGATAGGCGGCAGGTGAGTGG - Intergenic
1109161465 13:58980473-58980495 GTGCACAGGGTGAAGGTGGGAGG - Intergenic
1109370271 13:61413731-61413753 GAGGCCAGGCTGAAGGAGAGAGG + Exonic
1109388813 13:61667351-61667373 GGGTACAGACTGAAGATGAATGG + Intergenic
1109642603 13:65209916-65209938 GGGGCCTGGCTGAAGGTGATTGG - Intergenic
1109865739 13:68260800-68260822 GGGTACAGGCTGAAGATGAATGG - Intergenic
1110257117 13:73444698-73444720 GGGTACAGACTGAAGGTGAATGG - Intergenic
1111079052 13:83277976-83277998 GGGAACAGACTGAAGATGAATGG - Intergenic
1112364113 13:98742233-98742255 GGGGCCAGGCTGCGGCTGAGTGG - Intronic
1112507883 13:99985693-99985715 GGGGACAGGGAGAGGGAGAGAGG - Exonic
1113698730 13:112366882-112366904 GGGAACAGGCTGATGGAGGGGGG + Intergenic
1114343338 14:21768654-21768676 GTGCACAGGATGAAGGGGAGGGG + Intergenic
1114360615 14:21968255-21968277 GGGGAAAGGCTGGACATGAGGGG + Intergenic
1114454857 14:22847786-22847808 GGTGACGGGCTGTGGGTGAGAGG + Intronic
1114712771 14:24795070-24795092 GGGTACAGCGTGAAGGAGAGGGG - Intergenic
1114985505 14:28222823-28222845 GGGGGCAGGCTAGAGTTGAGGGG - Intergenic
1115654042 14:35426063-35426085 GGGGACAGTGTGACTGTGAGGGG - Intergenic
1116192221 14:41675599-41675621 GGGGACAGGGAGAGGGAGAGGGG + Intronic
1116389957 14:44380163-44380185 GGGTACAGACTGAAGATGAATGG + Intergenic
1118366686 14:65102382-65102404 GGGGAAGGGGTGAAGGGGAGGGG + Exonic
1118806806 14:69245046-69245068 TGGGACAGGCAGAAGGTGCTGGG - Intergenic
1119856257 14:77903492-77903514 GGGGACTGGGAGAGGGTGAGGGG + Intronic
1120663969 14:87283799-87283821 GTGCTCAGGCTGAAGGTGGGTGG + Intergenic
1121016015 14:90549529-90549551 GGGCTCAGGGTGTAGGTGAGGGG + Intronic
1121383404 14:93494296-93494318 GGGGCCTGGCAGAAGGTGATTGG - Intronic
1121458473 14:94054794-94054816 GGGGAGTGACTGAAGGTGGGAGG - Intronic
1121925909 14:97927093-97927115 GGGGAGAGGCATAAGGTTAGAGG + Intronic
1122078751 14:99252684-99252706 GGAGACAGGCAGCAGGTGACAGG - Intronic
1122291800 14:100684767-100684789 GGGGACAGGGTCAACATGAGTGG - Intergenic
1124160604 15:27265235-27265257 GGGGGCAGGCTTAGGGTCAGCGG - Intronic
1125592425 15:40863129-40863151 GGAACCAGGCAGAAGGTGAGGGG + Intergenic
1126132257 15:45353181-45353203 TGAGACAGGCTGGAGGTGGGCGG + Intergenic
1127361388 15:58247649-58247671 GAAGTCAGGCTGCAGGTGAGAGG + Intronic
1127701102 15:61502060-61502082 GGGGACAGTCTGGAGTTGTGGGG + Intergenic
1127873008 15:63088862-63088884 GGGGGAAGGCTGAAGGTCAAAGG + Intergenic
1128047823 15:64634625-64634647 GGGGCAAGACTGAAGGTGAAGGG - Intronic
1128214089 15:65922464-65922486 GGGGGCAGACTGAGGGTGAAGGG + Exonic
1128940351 15:71782964-71782986 GGGGACAGGGAGAGGCTGAGAGG + Exonic
1129258393 15:74347821-74347843 GGGCAGAGGCTGGGGGTGAGGGG - Intronic
1129262860 15:74378534-74378556 GGGAACCGGGTGAAGGGGAGAGG - Intergenic
1129265673 15:74391993-74392015 GGGCAGAGGCTGGAGGTGTGGGG - Intergenic
1129357516 15:75001452-75001474 GGAGACAAGATGAAGGTGAGAGG - Intronic
1129474805 15:75777833-75777855 GGGGACAGCCTGATGGCAAGTGG - Intergenic
1129661104 15:77553650-77553672 GGGGACAGGCTGCCGGTGGGGGG - Intergenic
1129687668 15:77695802-77695824 GGGGACAGGCTGATGGTGCTGGG - Intronic
1129732948 15:77942213-77942235 GGATCCAGGCTGTAGGTGAGGGG - Intergenic
1130149866 15:81303294-81303316 GTGGACAGGGTGAATGAGAGAGG + Intronic
1132388942 15:101424542-101424564 GGCGACAGGCTGAAGATAAATGG + Intronic
1132672003 16:1105862-1105884 GGGGACAGGCCGTGGGTGGGAGG + Intergenic
1132956295 16:2595836-2595858 GTGGATAAGCGGAAGGTGAGTGG + Exonic
1133303362 16:4796092-4796114 GGGTGGAGGCGGAAGGTGAGGGG + Intronic
1133349820 16:5093956-5093978 GGGGACAGGATGGAGGGGACGGG + Intronic
1134401529 16:13914501-13914523 GGGGAGAGGCTGAAGGGGGAGGG - Intergenic
1135077196 16:19403710-19403732 GGGTACAGACTGAAGATGAATGG + Intergenic
1135698469 16:24610773-24610795 GTGGAAAGGGGGAAGGTGAGAGG - Intergenic
1136043685 16:27599672-27599694 GGTGCCAGGCTGCAGGTGAGAGG - Intronic
1136098326 16:27974761-27974783 GGGGACTGGGTGACCGTGAGAGG + Intronic
1136350061 16:29700980-29701002 GAGGACAGGCATCAGGTGAGCGG - Intergenic
1136999306 16:35215731-35215753 GGGGGCAGGCGGTAGGTGGGAGG + Intergenic
1137439250 16:48483927-48483949 GGGGAGAGGCGGAGGGGGAGAGG + Intergenic
1137977270 16:53042328-53042350 GGGGAGAGGCAGAATGGGAGAGG - Intergenic
1138277436 16:55746035-55746057 GAGGGCAGGCAGAAGGAGAGAGG + Intergenic
1138595412 16:58026781-58026803 GGACACAGGCTGAATGTAAGGGG - Intronic
1139216512 16:65130454-65130476 AGGGATAGGCTGAAGATGATCGG - Intergenic
1139822909 16:69734866-69734888 GGAGAAAAGGTGAAGGTGAGGGG - Intergenic
1140638955 16:76949362-76949384 GGGGCCTGGCTGGAGGTGACTGG - Intergenic
1141196064 16:81862198-81862220 GAGGAAAGACTGAAGGCGAGAGG + Intronic
1141235446 16:82211634-82211656 GGGGCCAGGTGGAAGGTGATTGG - Intergenic
1141461641 16:84181492-84181514 GGGGACAGGCTGATGGGGAAGGG + Intronic
1141751761 16:85962869-85962891 GGGGACCCGCTGAGGTTGAGAGG - Intergenic
1141944271 16:87298729-87298751 GTGGACAGTCTGGAGGTGACAGG - Intronic
1142611545 17:1111307-1111329 GGGGACAGGGTGGAGTAGAGAGG - Intronic
1143286497 17:5793775-5793797 GGGTACAATCTAAAGGTGAGAGG - Intronic
1143532716 17:7514411-7514433 GGGGACAGGCAGGGGGTGGGTGG - Exonic
1143534040 17:7525053-7525075 GGGCACAGACTGAAGATGAATGG + Intergenic
1143580712 17:7824148-7824170 GGGGACAGGATGAACACGAGTGG - Exonic
1144350708 17:14393286-14393308 GGGGATAGGATGGAGGAGAGAGG + Intergenic
1144890949 17:18494097-18494119 GGGGATAGAGTGCAGGTGAGGGG + Intronic
1145141274 17:20450221-20450243 GGGGATAGAGTGCAGGTGAGGGG - Intronic
1145794640 17:27648704-27648726 GGGGATAGAGTGCAGGTGAGGGG + Intronic
1145963501 17:28901305-28901327 GGGCAGAGGCTAAATGTGAGCGG + Intronic
1146185981 17:30724536-30724558 GGGGACAGGCTGAGGCTGCAGGG + Intergenic
1147237680 17:39069761-39069783 GGGGAGAGGGAGAAGGGGAGAGG + Intronic
1147628014 17:41912385-41912407 GGGGTCAGGATGAACGTGTGTGG - Intronic
1147647574 17:42043059-42043081 AGGGCCAGGCTGAAGGTGGAGGG - Intronic
1148108258 17:45130824-45130846 GGGGAGAGGCTGGGGGTGGGAGG - Intronic
1148235771 17:45968038-45968060 GGGGACAGGATGAAGGGCGGAGG - Intronic
1148756955 17:49978226-49978248 GGGGACATGATGGAGCTGAGAGG + Intergenic
1148858370 17:50591385-50591407 GGGGAGAGGGTGAAGGTGCAGGG + Intronic
1149046815 17:52255587-52255609 GGGGACAAGAAGAAGATGAGGGG + Intergenic
1149922788 17:60675071-60675093 GGTTACAGGATGAAGGTGAGAGG - Intergenic
1151591528 17:75047467-75047489 TGGGTCAGGCTGAACGTGGGAGG + Exonic
1152223415 17:79081731-79081753 GGGGAAAGGCTGAGGCTGTGTGG + Intronic
1152671960 17:81613814-81613836 GGGGCCAAGCAGAGGGTGAGAGG - Intronic
1152688255 17:81705474-81705496 GGGAAGAGGCTCAAGGTGGGAGG + Intronic
1152719814 17:81917970-81917992 GCGGGCAGGCGGACGGTGAGCGG + Intronic
1152728143 17:81957772-81957794 GGGGCAGGGCTGGAGGTGAGGGG - Intronic
1153341947 18:3984538-3984560 GGTGACAGGGTGAATGTGAGAGG - Intronic
1153434757 18:5057604-5057626 AGGGACAGGCGGAAGGTCGGAGG - Intergenic
1154250165 18:12737664-12737686 GGGGACGGGCTGGAGCTGCGGGG + Intergenic
1154349207 18:13568961-13568983 GGGTAGAGGGTGCAGGTGAGAGG - Intronic
1154411384 18:14143905-14143927 GGCAACAGGCTGCATGTGAGAGG - Intergenic
1155195780 18:23472588-23472610 AGGGACAGGCTAGAGGTGTGGGG - Intronic
1156045408 18:32871888-32871910 GGGGACAGTGTTGAGGTGAGGGG + Intergenic
1156219731 18:35039213-35039235 GGGGACAGTCTGAAATTGAAAGG - Intronic
1156971900 18:43166896-43166918 GGGTACAGACTGAAGATGAATGG - Intergenic
1157328696 18:46687633-46687655 GGGGAGGAGCTGCAGGTGAGCGG - Intronic
1157564213 18:48668742-48668764 AGGGGCAGGAGGAAGGTGAGAGG - Intronic
1158267586 18:55677278-55677300 GGGGACAGACTATAGGTCAGTGG + Intergenic
1158284347 18:55862902-55862924 GGCAACCGGCTGAAGGTGTGTGG + Intergenic
1158894764 18:61902434-61902456 GGGGAGAAGGTCAAGGTGAGAGG - Intergenic
1159003394 18:62992373-62992395 GGAGCCGGGCTGCAGGTGAGCGG + Intergenic
1159309445 18:66688027-66688049 GGGGAAAGACTGAAGATGAATGG - Intergenic
1159382307 18:67676059-67676081 GGGGTCCTGCTGAGGGTGAGAGG + Intergenic
1159696615 18:71565649-71565671 GGGGACTGGCAGGAGGTGACTGG - Intergenic
1159973031 18:74676970-74676992 GGGGAAAGGATGAAGAGGAGAGG - Intronic
1160451160 18:78966664-78966686 GGAGTCTGGCTGCAGGTGAGGGG + Intergenic
1160809735 19:1008169-1008191 TCGGACAGGTTGGAGGTGAGCGG - Exonic
1160906350 19:1453398-1453420 GGGGACAGGGCGGAGGTCAGCGG - Intronic
1161284894 19:3463905-3463927 GTGGAGAGGCTGGAGGGGAGGGG - Intronic
1161407987 19:4101149-4101171 GGCGGCAGGCTGCGGGTGAGGGG + Intronic
1161608727 19:5229367-5229389 GGAGAGAGGAGGAAGGTGAGCGG + Intronic
1161852692 19:6745985-6746007 GGGGATAGGTTGAAGGGGTGGGG - Intronic
1161991629 19:7687475-7687497 CTGGACAGGCTGATGGGGAGTGG - Exonic
1162526254 19:11208653-11208675 GGGGACTGGGTGCAGGAGAGGGG - Intronic
1162528649 19:11222671-11222693 GGAGATGGACTGAAGGTGAGAGG + Intronic
1162811099 19:13164632-13164654 GGGGACAGGCTGAAGAACAATGG + Intergenic
1162972796 19:14191195-14191217 GGGGACAGGCTGAGGCTGGAGGG - Intronic
1163019853 19:14476120-14476142 GGGGACAGGATGAAACTGAGTGG - Intergenic
1163289755 19:16371568-16371590 GGGGAGAGGTTAAAGGTGACTGG + Intronic
1163529520 19:17841603-17841625 GGGGTAAGGCTGAAGGGGAGGGG + Intronic
1163747133 19:19055225-19055247 GCGGCCTGGCTGGAGGTGAGCGG + Intronic
1163771281 19:19192671-19192693 GTGGGCAGGGTAAAGGTGAGCGG + Intronic
1165075407 19:33277517-33277539 GTGGGCAGGCTGAAGCTGATTGG + Intergenic
1165423986 19:35735701-35735723 TGGGACAGGCTGACTTTGAGAGG - Intronic
1165471253 19:36006167-36006189 TGGGACAGTCAGGAGGTGAGTGG + Intronic
1165473438 19:36016268-36016290 GGGGAAAGGCTGGGGGTGATGGG - Intronic
1166219771 19:41356958-41356980 GGGGAAAGGCAGAAGGGGACAGG - Intronic
1166380762 19:42353980-42354002 GGGGAGAAGGTGAGGGTGAGTGG - Exonic
1166539410 19:43595423-43595445 GGGGACAGGGTGAAGGACTGAGG - Intronic
1166774363 19:45303317-45303339 GGCAACAGGCTGCAGGTGAGGGG - Exonic
1167169026 19:47818708-47818730 GGGGACAGTCTGAAGATGTATGG - Intronic
1167459802 19:49618859-49618881 GGGGACAGACTGGAGGAGTGAGG - Intronic
1167470409 19:49672559-49672581 GGGCACAGGGAGGAGGTGAGTGG + Intronic
1167480908 19:49730646-49730668 GCGCCCAGGCTGAAGGAGAGTGG + Intergenic
1167571170 19:50290067-50290089 GGGGAGAGGCTGTATGTGGGTGG - Intronic
1167580230 19:50337009-50337031 GAGGACAAGCTGACTGTGAGTGG - Intronic
1167583797 19:50361655-50361677 GAGGACAAGCTGACTGTGAGTGG - Exonic
1167640459 19:50678779-50678801 GGGGTCAGGGTGATGGGGAGGGG + Intronic
1167640480 19:50678835-50678857 GGGGTCAGGATGATGGGGAGGGG + Intronic
1167640496 19:50678872-50678894 GGGGTCAGGGTGATGGGGAGGGG + Intronic
1167640526 19:50678946-50678968 GGGGTCAGGGTGATGGGGAGGGG + Intronic
1167640550 19:50679001-50679023 GGGGTCAGGGTGATGGGGAGGGG + Intronic
1167640558 19:50679020-50679042 GGGGTCAGGGTGATGGGGAGGGG + Intronic
1167640566 19:50679039-50679061 GGGGTCAGGGTGATGGGGAGGGG + Intronic
1167640580 19:50679077-50679099 GGGGTCAGGGTGATGGGGAGGGG + Intronic
1167640596 19:50679114-50679136 GGGGTCAGGGTGATGGGGAGGGG + Intronic
1168316194 19:55485766-55485788 CTGGAGATGCTGAAGGTGAGAGG + Exonic
925131825 2:1499214-1499236 GAGGGCAGGCGGAAGGTCAGAGG - Intronic
925251753 2:2444931-2444953 GGGCGCTGGCTGCAGGTGAGGGG + Intergenic
925317369 2:2936580-2936602 GGGTACACGCTCAAGGTGACGGG + Intergenic
925404723 2:3598664-3598686 GGGCACAGGCAGCGGGTGAGGGG + Intronic
925665655 2:6252639-6252661 GGGGGGAAGCTGAGGGTGAGAGG - Intergenic
925670603 2:6306115-6306137 GGGGCCAACCTGAGGGTGAGAGG - Intergenic
925918367 2:8623256-8623278 GAGGTCAGGCTGTAGGTGAATGG - Intergenic
926390842 2:12390964-12390986 GGGGACTGGCTGCAGGTGAGAGG - Intergenic
927290523 2:21400634-21400656 TGGGATAGCCTGAAGGTGAAAGG - Intergenic
927997897 2:27499115-27499137 GAGGACAGACTCAAGGTCAGTGG - Intronic
928833612 2:35518071-35518093 GGGTACAGACTGAAGATGAATGG + Intergenic
929575199 2:43047330-43047352 TGGGAGGGGCGGAAGGTGAGGGG - Intergenic
929997865 2:46840322-46840344 GGGGCCAGGCTGGAGGCGAGAGG - Intronic
931262865 2:60635602-60635624 GGGGAGAGCCTGCAGGTGAGTGG + Intergenic
931878381 2:66539829-66539851 GGAGGCAGGCAGAAGGGGAGGGG - Intronic
932838690 2:75061184-75061206 GGGGAGAGGCTGGAGGGGAGAGG + Intronic
932887720 2:75561904-75561926 GAGGAGAGGATGAAGGAGAGAGG + Intronic
933130972 2:78673689-78673711 GGGTACAGACTGAAGATGACTGG + Intergenic
933948566 2:87308938-87308960 GGGGACAGGCTGGGGGTGGCGGG + Intergenic
934613665 2:95758298-95758320 GGAGACAGGCTGAATGAGGGTGG - Intergenic
935354469 2:102186365-102186387 TGTGATAGGCTGAAGGTCAGTGG - Intergenic
935424221 2:102903076-102903098 GGGGACAGGCTGAGGCTCAATGG + Intergenic
936167974 2:110140257-110140279 AGGGACAGGTGGAAGCTGAGCGG + Intronic
936331633 2:111552657-111552679 GGGGACAGGCTGGGGGTGGCGGG - Intergenic
936521286 2:113213366-113213388 GGGGAGAGGGAGAAGGGGAGAGG + Intergenic
936733189 2:115407932-115407954 GGGTACAGACTGAAGATGAATGG + Intronic
936840046 2:116758065-116758087 GGGTACAGACTGAAGATGAATGG - Intergenic
937119821 2:119433340-119433362 TGGGCCAGGCTGCAGCTGAGAGG + Intronic
937993851 2:127678990-127679012 TGGGACTGGCAGAAAGTGAGGGG + Intronic
938128628 2:128692325-128692347 GAGGACAGGGTGCAGGTGTGGGG - Intergenic
938574108 2:132588083-132588105 GGAAAGAGACTGAAGGTGAGAGG + Intronic
938759606 2:134412097-134412119 GGGGACAAGCTGCAGTTCAGTGG - Intronic
938842197 2:135174356-135174378 GGGCACATGCTGAAGAGGAGGGG - Intronic
939629085 2:144513387-144513409 GGGGACAGTGTGAAGGAGAAGGG - Intronic
940773050 2:157858969-157858991 GGTGACAGGCTGTATTTGAGAGG - Intronic
940980058 2:159991406-159991428 TGGGACAGGCTGAAAGTGCAGGG + Intronic
941249831 2:163148016-163148038 GGGTACAGACTGAAGATGAATGG - Intergenic
941853548 2:170207743-170207765 GGGTACAGACTGAAGATGAATGG + Intronic
942964246 2:181871132-181871154 AGGGAAAGTCTGAAGGCGAGGGG - Intergenic
943428657 2:187769956-187769978 GGGGCCAGGTTGGAGGTGACTGG + Intergenic
943906265 2:193503444-193503466 GGGTACAGACTGAAGATGAATGG + Intergenic
944810651 2:203324597-203324619 GGAGATAGGCTGAATGTGTGTGG + Intergenic
945623548 2:212171585-212171607 GGGACCAGGTTGAAGGTGATTGG + Intronic
945706959 2:213247664-213247686 AGGGACAGGGTGCAGGGGAGAGG - Intergenic
945942993 2:215968427-215968449 GGGGCCAGGCAGAGGGAGAGAGG - Intronic
946236640 2:218328380-218328402 GGGGACAGGGTGCAGGGGTGAGG - Intronic
946332439 2:219018010-219018032 GGGGACAGTCAGAGAGTGAGGGG + Intronic
946502076 2:220260070-220260092 GGAGAGAGGCTCAAGGGGAGGGG + Intergenic
946890571 2:224271933-224271955 GGGATCAGGTTGAAGCTGAGAGG - Intergenic
948386654 2:237584938-237584960 AGGGCCAGGGTGATGGTGAGAGG - Intronic
948429922 2:237912620-237912642 GAGGACAAGCTGAAGGTGATGGG - Intergenic
948452054 2:238082031-238082053 AGGGACAGGCTGACGGGGAAAGG - Exonic
948562534 2:238864182-238864204 GGGAAGGGGCTGGAGGTGAGGGG + Intronic
948688578 2:239687766-239687788 GGGGAAAGTCTGACGGGGAGTGG - Intergenic
948756421 2:240162146-240162168 GGAGACAGGCAGAGGGAGAGTGG + Intergenic
948795589 2:240400651-240400673 GGGGACAGGCTGCAGACGGGAGG + Intergenic
948796673 2:240406487-240406509 GGGGGCAGGAGGAAGGAGAGAGG - Intergenic
1168770045 20:408782-408804 GGGCACAGGCTGGAGGTGGCTGG + Intronic
1168990253 20:2088935-2088957 GGGGAGGGGCTGCAGGAGAGAGG + Intergenic
1169860848 20:10150759-10150781 GGGGACTGGCGGGAGGTGATTGG - Intergenic
1171350867 20:24502143-24502165 GGGAACAGAAAGAAGGTGAGGGG - Intronic
1171431478 20:25085581-25085603 GGGGTCAGGCTGGAGGTGGGTGG - Intergenic
1172026421 20:31951867-31951889 GCGGACAAGCGGCAGGTGAGAGG - Exonic
1172128927 20:32642952-32642974 GGGGCCAGGCTGCCGGTGGGAGG + Intergenic
1172237542 20:33388581-33388603 GGGGAGAGGGAGAAGGAGAGAGG - Intronic
1172840377 20:37899437-37899459 GGGCAGAGGCTGAATGTGAACGG - Intergenic
1173105259 20:40127643-40127665 GGGCATAGGATGGAGGTGAGAGG - Intergenic
1173125178 20:40330037-40330059 GGGGACAGAATGAGGGTGATGGG + Intergenic
1173251401 20:41366003-41366025 GGGGCCAGGCTGACTGCGAGAGG + Intronic
1173563700 20:44023951-44023973 GGGGACGGGCTAAGGGAGAGGGG - Intronic
1173988442 20:47280874-47280896 GGGGAAGGGCTGAGGCTGAGAGG - Intronic
1174069838 20:47891801-47891823 AGGGACAGGCTGAAGGTCTTCGG + Intergenic
1174167103 20:48592789-48592811 CAGGACAGGCTGCAGGTGAGAGG + Intergenic
1174301559 20:49585927-49585949 GGGGACAGGCCAGAGGTCAGAGG + Intergenic
1174554003 20:51381157-51381179 GAGGACAGGCAGAAGGGGAAAGG + Intergenic
1175967715 20:62667896-62667918 GTGGACGGCCAGAAGGTGAGTGG + Exonic
1176207383 20:63896513-63896535 GGGGCCAGTCTGAGGGTGGGTGG - Intronic
1176285164 21:5015643-5015665 GGGAACAGGCTTAGGGTTAGGGG - Intergenic
1176377247 21:6092729-6092751 GGGCCCAGGCTGGAAGTGAGAGG - Intergenic
1176739809 21:10590887-10590909 TGGGGCAGGATTAAGGTGAGGGG + Intronic
1176861673 21:14014512-14014534 GGCGACAGGCTGCATGTGAGAGG + Intergenic
1177225918 21:18255963-18255985 GGGGACAGAATGAAGGTAATTGG - Intronic
1177567487 21:22843838-22843860 GGGTACAGACTGAAGATGAGGGG + Intergenic
1177758386 21:25373901-25373923 GGAGAGAGGCTGGAAGTGAGAGG - Intergenic
1178619582 21:34161906-34161928 GGGCACAGACTGAAGATGAAGGG + Intergenic
1179215092 21:39360573-39360595 GGGGAAAGGCTGAAGCGGGGAGG + Intergenic
1179746228 21:43445515-43445537 GGGCCCAGGCTGGAAGTGAGAGG + Intergenic
1179836684 21:44039235-44039257 GGGGACGGGCTGACGGAGATGGG - Intronic
1179872017 21:44247832-44247854 GGGAACAGGCTTAGGGTTAGGGG + Intronic
1180030266 21:45202001-45202023 GGGGACAGGTGCAGGGTGAGAGG + Intronic
1180248718 21:46565347-46565369 AGGGACAGGCTGAAGGAATGAGG - Intronic
1181461642 22:23089338-23089360 GGGGACAGCCTGGAGGTTACGGG + Intronic
1181484388 22:23221382-23221404 GGGAACAGGGTGAAGGAGGGAGG - Intronic
1183004855 22:34892549-34892571 GGGAAGAGGCTGAAGGGGAGGGG + Intergenic
1183076841 22:35432729-35432751 GGTGAGAGGCTGGAGGAGAGTGG + Intergenic
1183083760 22:35474112-35474134 CTGGACAGGCTGGTGGTGAGAGG + Intergenic
1183493125 22:38127281-38127303 GGGGACAGGGTGCAGGGGAGGGG + Intronic
1183590346 22:38776182-38776204 GAGGACGGGCTGAAGGTGAAAGG - Intronic
1183744514 22:39685265-39685287 GGGGAGGGGCTGCAGGTGGGGGG + Intronic
1183787510 22:40038709-40038731 GGGGACAGGCAGAGGAAGAGGGG + Exonic
1184035375 22:41915416-41915438 GGGGACGGGAAGGAGGTGAGAGG - Intergenic
1184110703 22:42392475-42392497 GGAGAGGGGCTGAAGGTGAGAGG + Intronic
1184240167 22:43207672-43207694 GGGCAGAGGCTGGAGGTGAAAGG - Intronic
1184651561 22:45921586-45921608 GGGGTCAGGCAGGTGGTGAGTGG - Exonic
1184658360 22:45953321-45953343 GGGGACATGGTGACTGTGAGGGG - Intronic
1184882251 22:47315920-47315942 AGGGCCAGGCTGCAGGTGTGGGG - Intergenic
1184907651 22:47499638-47499660 GGGGACAGGCTGATGGGAATAGG + Intergenic
1185048235 22:48539896-48539918 GGGTACAGGCAGAAGGTGGGAGG + Intronic
1185193776 22:49455322-49455344 GGGGAGTGGCTAAAAGTGAGTGG + Intronic
1185366831 22:50440710-50440732 GGCAACAGGCTGCATGTGAGAGG + Intronic
1185384745 22:50526548-50526570 GGGGACGGGGTGTAGGGGAGCGG - Intronic
949097380 3:101404-101426 TAGGACAGGGTGAAGGTGAATGG - Intergenic
949382838 3:3465036-3465058 GGGGAGAGGGGGAAGGGGAGAGG + Intergenic
949523462 3:4878935-4878957 GGGGACACTTTGAAGGTGTGGGG - Intronic
949668061 3:6364546-6364568 GGGGCCAGCCAGAGGGTGAGGGG + Intergenic
949812030 3:8016395-8016417 GGGTACAGACTGAAGATGAATGG + Intergenic
950431623 3:12954286-12954308 GGAGACAGGCTGGGGATGAGAGG + Intronic
950487225 3:13281005-13281027 GGGGACAGGAGGATGCTGAGAGG - Intergenic
950521073 3:13498486-13498508 GGAGACAAGCAGAGGGTGAGGGG - Intronic
950544665 3:13631253-13631275 AGGGACAGGCTGACTGTCAGTGG + Intronic
951404011 3:22271681-22271703 GGAGACAGGCAGAGGGTGGGGGG - Intronic
951656086 3:25009994-25010016 TGGGACTGGCAGAAGGTAAGAGG - Intergenic
951719106 3:25679556-25679578 GGGGAAAGGCGGAGGGCGAGGGG + Intergenic
951742402 3:25939042-25939064 GTGGACAAGCAGAGGGTGAGAGG + Intergenic
951899391 3:27642056-27642078 GGGAGGAGGCTGAAGGAGAGTGG + Intergenic
952193333 3:31046802-31046824 GGATACAGGCTGAAGATGAATGG - Intergenic
952399668 3:32951808-32951830 GGGGACAGGTAGAAGGTGTGTGG - Intronic
952455150 3:33465747-33465769 GGGCACAGACTGAAGATGAATGG + Intergenic
953224287 3:41002281-41002303 GGGCACAGGCTGGGGGTGTGGGG - Intergenic
953569050 3:44057212-44057234 AGGGACAGGTTGAGGGTGGGTGG - Intergenic
954216239 3:49125990-49126012 GTGGACAGGCTGATGAGGAGGGG + Exonic
954257936 3:49419206-49419228 GGGCACAGGATGCATGTGAGGGG - Intronic
954455032 3:50593129-50593151 GGGGACAGCCAGATAGTGAGAGG - Intergenic
954910685 3:54104696-54104718 GGAGACAGTCAGCAGGTGAGCGG + Intergenic
956028359 3:65008346-65008368 GGGGTGAGCCTGAGGGTGAGGGG + Intergenic
956134867 3:66088732-66088754 TGGAAAAGCCTGAAGGTGAGAGG + Intergenic
957083387 3:75658185-75658207 GGGGACAGCCGGGAGGAGAGAGG + Intergenic
958557205 3:95695263-95695285 GGGGCCTGGCTGAAGGTGGAAGG + Intergenic
958907926 3:99962144-99962166 CTGGAAAGGCTGAAGGTGAGGGG + Intronic
959087655 3:101868448-101868470 GAGGACACGAAGAAGGTGAGTGG + Intergenic
959431616 3:106260922-106260944 GGGTACAGACTGAAGATGAATGG - Intergenic
960047655 3:113212633-113212655 GGGGCGAGGCTGAAGCCGAGTGG + Intronic
961300716 3:125920407-125920429 GGGGACAGGATGGAGGGGAGGGG - Intergenic
961344742 3:126256638-126256660 GGGAACTGGCTGATGGGGAGGGG + Intergenic
961509790 3:127393808-127393830 GAGGAAAAGCTGAAGGTGATAGG + Intergenic
961887786 3:130107681-130107703 GGGGACAGGATGGAGGGGAGGGG + Intronic
962469565 3:135693770-135693792 TGCGAAAGGCTTAAGGTGAGGGG - Intergenic
962625201 3:137219240-137219262 GGGAAAATGTTGAAGGTGAGAGG + Intergenic
962975362 3:140441610-140441632 GTGCAGAGGCTGAAAGTGAGGGG - Intronic
963626159 3:147676700-147676722 GGGGAGGGGTTGAAGGTGTGGGG - Intergenic
963948435 3:151171407-151171429 AGGGACAGGCTAAAGGTGGCAGG + Intronic
964048441 3:152360472-152360494 GGGGACAGGAAGAAGATCAGGGG - Intronic
964609652 3:158598313-158598335 GGGGACAGGAGGGAGGTGTGGGG + Intronic
964968012 3:162522178-162522200 GGGACCTGGCTGAAGGTGATTGG - Intergenic
964980288 3:162669756-162669778 GGGTACAGACTGAAGATGAATGG - Intergenic
965501335 3:169459670-169459692 GGGGACAGGTTGAGGGGGAAGGG - Intronic
966242960 3:177774998-177775020 AGGGCCAGGCTAGAGGTGAGAGG + Intergenic
966466078 3:180232630-180232652 GGGTACAGGCTGAAGATGGATGG - Intergenic
966523703 3:180899246-180899268 GGGTACAGACTGAAGATGAATGG - Intronic
966557153 3:181275503-181275525 GGAGACAGGCTCAAGGCAAGTGG + Intergenic
966750610 3:183318060-183318082 CGGGACAAGCTGCAGGTGAGCGG - Exonic
966939326 3:184735520-184735542 GGGGACATGCTGAGGCTTAGGGG - Intergenic
967289031 3:187901431-187901453 GGGGATACTCTGAAGGTGAATGG + Intergenic
967311356 3:188109392-188109414 GGGGTCAGGCTGAAGAGGTGGGG + Intergenic
967876905 3:194273642-194273664 GTGGACTGGCTGCAGGTGTGAGG + Intergenic
968148964 3:196322078-196322100 GGGGCCTGGCAGAAGGTGTGTGG - Intronic
968524414 4:1048690-1048712 GGGGAAGGGCGGCAGGTGAGAGG - Intergenic
968530156 4:1087093-1087115 GAGGACGGGGTGGAGGTGAGAGG + Intronic
968549817 4:1216470-1216492 GTGGACAGGCTGCAGGGGAGTGG - Intronic
968573685 4:1355231-1355253 GGGGAAAGGCGCAGGGTGAGTGG + Exonic
968620178 4:1600419-1600441 GGGGAGGGGCTGAGGGTTAGAGG - Intergenic
968728980 4:2261046-2261068 GGGGGCAGGCTGCAGGGCAGGGG - Intronic
968996921 4:3951613-3951635 GGGGACAGGATGGAGGGGAAGGG + Intergenic
969135959 4:5029082-5029104 GGGGACTGGTGGAAGGTGATTGG - Intergenic
969414144 4:7047917-7047939 GGGGACGGGGAGATGGTGAGAGG - Intronic
969533519 4:7742025-7742047 GGGGACAGGTGGAAGGGGTGGGG - Exonic
969554695 4:7898439-7898461 GGTGAAAGGCGGAAGGAGAGAGG - Intronic
969757085 4:9157065-9157087 GGGGACAGGATGGAGGGGAGGGG - Intergenic
970529024 4:16963321-16963343 GGGGCCTGGCGGAAGGTGACTGG - Intergenic
971345908 4:25811403-25811425 GGAAACAGGCTGAGGGAGAGTGG + Intronic
973028096 4:45299608-45299630 GGGGCCTGGCAGAAGGTGACTGG + Intergenic
973613502 4:52658758-52658780 GGGGATAAGCTGGAGGTGGGGGG - Intronic
974290904 4:59928882-59928904 GGGGCCTGGTTGGAGGTGAGTGG - Intergenic
974963834 4:68736045-68736067 GGGTACAGACTGAAGGTGAATGG + Intergenic
976345321 4:83993449-83993471 GGGTACAGACTGAAGATGAATGG - Intergenic
977704622 4:100057507-100057529 GGGGAGAGGCTGAAATTTAGTGG + Intergenic
978737885 4:112104976-112104998 AGGGACAGGGTGTAGGGGAGTGG - Intergenic
979017719 4:115455227-115455249 GGGGATAGGGTGAAGGTGGGAGG + Intergenic
979433990 4:120667385-120667407 TGGGACGGGCTGATGGTGAGTGG + Intergenic
979500761 4:121437126-121437148 GGGTACAGACTGAAGATGAATGG - Intergenic
980153962 4:129081655-129081677 GGGGCCTGGTTGAAGGTGAGTGG - Intronic
980722910 4:136720660-136720682 GGGTACAGACTGAAGATGAATGG - Intergenic
981255923 4:142660376-142660398 GGGTACAGACTGAAGATGAATGG - Intronic
981324219 4:143427798-143427820 GGGTACAGACTAAAGGTGAATGG + Intronic
983069712 4:163254103-163254125 AGGGACAGCCTGAAGGATAGGGG - Intergenic
983316370 4:166137309-166137331 GGTGACTGGATGAAGGTGAATGG - Intergenic
983930567 4:173449027-173449049 AGAGACAGGCTGAAGTGGAGAGG + Intergenic
984327796 4:178275353-178275375 GGGTACAGACTGAAGATGAATGG - Intergenic
985108583 4:186523625-186523647 GGGGAGAGAATGGAGGTGAGGGG - Intronic
985448154 4:190038733-190038755 GGGGACAGCCGGGAGGAGAGAGG - Intergenic
985948098 5:3202231-3202253 GGTGACAGGCTGCAGGTGCAGGG - Intergenic
985948110 5:3202295-3202317 GGTGACAGGCTGCAGGTGCAGGG - Intergenic
985948122 5:3202359-3202381 GGTGACAGGCTGCAGGTGCAGGG - Intergenic
985948134 5:3202423-3202445 GGTGACAGGCTGCAGGTGCAGGG - Intergenic
985948145 5:3202487-3202509 GGTGACAGGCTGCAGGTGCAGGG - Intergenic
985948157 5:3202551-3202573 GGTGACAGGCTGCAGGTGCAGGG - Intergenic
985992344 5:3573913-3573935 AGGGACAGGCAGCAGGGGAGCGG + Intergenic
988098884 5:26653502-26653524 GGGGCCTGGTGGAAGGTGAGTGG - Intergenic
988564679 5:32312141-32312163 GTGGAAAGGATGATGGTGAGGGG + Intronic
988680648 5:33481061-33481083 GGGGAGAGGATGAAGGGGAGGGG - Intergenic
988808380 5:34761586-34761608 GGAGACAGGATGTAGGTAAGTGG - Intronic
991014334 5:61915277-61915299 GGGTACAGACTGAAGATGAATGG - Intergenic
991095936 5:62739663-62739685 GGGGATGGGATGAAGGTAAGGGG + Intergenic
991601180 5:68352762-68352784 GGGGAAAGGCTGGAGGTAATGGG + Intergenic
991674044 5:69074954-69074976 GGTGACAGGCTGCTGGTGGGAGG - Intergenic
992163856 5:74029130-74029152 AGGGATAGGCTGAAGATGAGAGG - Intergenic
992531976 5:77660664-77660686 GGGGCCTGGTGGAAGGTGAGTGG + Intergenic
992716341 5:79514326-79514348 GCGGAGAGGCTGATGGTGGGGGG + Intergenic
993326353 5:86542698-86542720 GGGGACAGGCTTAAGGTGAGAGG - Intergenic
993730930 5:91421888-91421910 GGAGAAAGGCAGAAGGGGAGAGG + Intergenic
994112586 5:96023490-96023512 GCAGACAGGCTGAAGTTTAGTGG + Intergenic
995393513 5:111663963-111663985 GGGAACAGACTGAAGATGAATGG + Intronic
997443526 5:133925498-133925520 GGGGACAGGGTGTACGTGGGCGG - Intergenic
997614246 5:135235755-135235777 GGGAACAGGCTGCAGGTGGGGGG - Intronic
997811695 5:136977002-136977024 GTGGACAGGCTGAAGTTCATGGG + Exonic
998138446 5:139686935-139686957 GGGCACAGGCTGCAGGTGAGAGG - Intergenic
998153794 5:139772491-139772513 TGGGACAGGGAGAAGGAGAGGGG - Intergenic
999008213 5:148005725-148005747 GGGTACAGACTGAAGATGAATGG - Intergenic
999134602 5:149310121-149310143 GAGGAGTGGCTGAAGGTGCGTGG + Exonic
999258382 5:150222484-150222506 GGGGAGAGGGTGGGGGTGAGAGG + Intronic
999373754 5:151072202-151072224 GGCGGCAGGCTGAAGCTCAGAGG + Intronic
999392336 5:151202655-151202677 GAGGAGACGCTAAAGGTGAGGGG - Intronic
1000039194 5:157472529-157472551 AGGGACAGGATGTAGGGGAGCGG - Exonic
1000056100 5:157608022-157608044 GGGGACTGGCTGGAGGTGGCAGG + Intergenic
1001775789 5:174328140-174328162 GGGGACAGGCTGCTGGTGACGGG + Intergenic
1001965840 5:175909250-175909272 GGGGAGCCGCTGGAGGTGAGAGG - Intergenic
1002136586 5:177111641-177111663 GGGGACTGGCTGATGGGGGGTGG + Intergenic
1002251106 5:177929950-177929972 GGGGAGCCGCTGGAGGTGAGAGG + Intergenic
1002782348 6:377097-377119 GGGAATAGGCTGAACGTGAGAGG + Intergenic
1002835442 6:861519-861541 GGGGGCAGGCAGAAGGTGTGCGG - Intergenic
1005041491 6:21604395-21604417 GGGCAGAGACTGAAGGTCAGGGG - Intergenic
1005887847 6:30110688-30110710 AGGGACAGGCAGAGGGTGAGAGG + Intronic
1006181484 6:32155769-32155791 TGGGACAGTATGGAGGTGAGTGG + Exonic
1006542730 6:34753719-34753741 GGAGACAGCCTGATGTTGAGGGG + Intergenic
1007272584 6:40649734-40649756 GGAGAGAGACAGAAGGTGAGAGG - Intergenic
1007346906 6:41237584-41237606 TGGGACGGGAGGAAGGTGAGGGG - Exonic
1007556377 6:42770052-42770074 GGGGACAGGCAGATGATGAGGGG - Intronic
1007790106 6:44303909-44303931 GGGGAGCGGCTGGAGGTGAAGGG + Intronic
1007814704 6:44513279-44513301 GGGCAAAGGCTGAAGATGACAGG + Intergenic
1008150007 6:47938882-47938904 GGGGCCAGGAAGAGGGTGAGGGG + Intronic
1008298155 6:49803612-49803634 GGGTAGAGGCTGGAGTTGAGAGG + Intergenic
1009796129 6:68470572-68470594 GCTCTCAGGCTGAAGGTGAGTGG - Intergenic
1010453638 6:76030405-76030427 GGGTACAGACTGAAGATGAATGG - Intronic
1010991645 6:82485946-82485968 GGGGACAGACTGAACATGAATGG - Intergenic
1011256736 6:85430150-85430172 TGGGACAGGTTGAAGGTTACAGG + Intergenic
1012804675 6:103879001-103879023 GGGTACAGGCTGAAGATGAATGG - Intergenic
1012912341 6:105132447-105132469 GGGGACACGGAGAAGGTGATAGG - Intronic
1014453914 6:121615085-121615107 GGGGAAGGGCTGAAGGTGTGAGG + Intergenic
1014524863 6:122490462-122490484 GGGGACTGGCGGGAGGTGATTGG + Intronic
1014936182 6:127387731-127387753 GGGAACAGGGTGGAGGTCAGTGG - Intergenic
1015813524 6:137185147-137185169 GGGGACAGATTGAAGATGAATGG + Intergenic
1016162039 6:140894320-140894342 GGGTACAGACTGAAGATGAATGG + Intergenic
1016330035 6:142945772-142945794 GGAGGCGGGCTGGAGGTGAGGGG - Intergenic
1017559736 6:155614591-155614613 GGGGACAGACTGAAGATGAATGG + Intergenic
1017734170 6:157346011-157346033 GGGGAAAGGCTGAAGGAAACTGG - Intergenic
1018602961 6:165565025-165565047 GGTAATAGGCTGAAAGTGAGAGG + Intronic
1018943667 6:168329385-168329407 GGGCACAGCATGGAGGTGAGAGG - Intergenic
1018943693 6:168329488-168329510 GGGCACAGCATGGAGGTGAGAGG - Intergenic
1018943714 6:168329569-168329591 GGGCACAGCATGGAGGTGAGAGG - Intergenic
1018973582 6:168546530-168546552 GGGGACAGGGCGAAAGTGATCGG - Intronic
1019154916 6:170032358-170032380 GGGGACAGGCTGAGGTCCAGGGG - Intergenic
1019265686 7:116367-116389 GGGCACAGGCTGGAGGTGTTGGG - Intergenic
1019283616 7:212586-212608 GGTGAGAGGGTGTAGGTGAGGGG + Intronic
1019482469 7:1273206-1273228 GGGGACGGGGTGCAGGTGTGGGG + Intergenic
1019482492 7:1273273-1273295 GGGGACGGGGTGCAGGTGTGGGG + Intergenic
1019482515 7:1273340-1273362 GGGGACGGGGTGCAGGTGTGGGG + Intergenic
1019482538 7:1273407-1273429 GGGGACGGGGTGCAGGTGTGGGG + Intergenic
1019482561 7:1273474-1273496 GGGGACGGGGTGCAGGTGTGGGG + Intergenic
1019482584 7:1273541-1273563 GGGGACGGGGTGCAGGTGTGGGG + Intergenic
1019482607 7:1273608-1273630 GGGGACGGGGTGCAGGTGTGGGG + Intergenic
1019482630 7:1273675-1273697 GGGGACGGGGTGCAGGTGTGGGG + Intergenic
1019482653 7:1273742-1273764 GGGGACGGGGTGCAGGTGTGGGG + Intergenic
1019482675 7:1273809-1273831 GGGGACGGGGTGCAGGTGTGGGG + Intergenic
1019482739 7:1274010-1274032 GGGGACGGGGTGCAGGTGTGGGG + Intergenic
1019482762 7:1274077-1274099 GGGGACGGGGTGCAGGTGTGGGG + Intergenic
1019775413 7:2909527-2909549 GGTGAGAGGCAGAGGGTGAGGGG - Intronic
1020321212 7:6939995-6940017 GGGGACAGGATGGAGGGGAGGGG + Intergenic
1021622238 7:22560319-22560341 GGTGCCAGGCTAAAGGAGAGAGG - Intronic
1022089394 7:27097694-27097716 GAGGAAAGGCTGAAGAGGAGTGG - Intergenic
1022322216 7:29297908-29297930 GGGTACAGACTGAAGATGAATGG + Intronic
1022500250 7:30878238-30878260 GGAGACAAGCTGCAAGTGAGAGG - Intronic
1022923562 7:35038292-35038314 GGAGCCAGGCTGAAGGTGATAGG + Intergenic
1023718836 7:43072373-43072395 GGGTACAGACTGAAGGCGAATGG + Intergenic
1023862795 7:44225994-44226016 GGGGCCAGGCTGAAACAGAGCGG - Intronic
1024438011 7:49381699-49381721 GGGTACAGACTGAAGATGAATGG - Intergenic
1024491495 7:49990510-49990532 GGGTACAGACTGAAGATGAATGG - Intronic
1026000863 7:66558235-66558257 GGGGTCAGGCTGAGTGTGGGAGG - Intergenic
1026487624 7:70835116-70835138 GGGGCCTGGTGGAAGGTGAGTGG - Intergenic
1027426793 7:78069172-78069194 GGGCAAAGGCTGAAGGGGTGGGG + Intronic
1027511664 7:79089832-79089854 GGGGCCTGTCAGAAGGTGAGGGG + Intronic
1028009372 7:85621139-85621161 GGGGACAGGCTGCAGATTGGAGG + Intergenic
1029109383 7:98204727-98204749 GGGGCCAGGCTGAGGCAGAGGGG + Intronic
1029546494 7:101212949-101212971 GGGGACAGACTGAGGCTGAGTGG + Intronic
1029630014 7:101744204-101744226 GAGGAAGGGCTGAAGGTGATGGG - Intergenic
1029640833 7:101817655-101817677 GGAGCCAGGTTGAAGGTGAGCGG + Intronic
1030245816 7:107383721-107383743 GGGTACAGACTGAAGATGAATGG - Intronic
1031874394 7:127121824-127121846 GGGGACTGGTAGGAGGTGAGTGG - Intronic
1032081459 7:128860526-128860548 GGGGTGAGGGTGAGGGTGAGGGG - Intergenic
1032482594 7:132258586-132258608 GGGGACAGGAAGGAGGAGAGTGG - Intronic
1032793970 7:135262938-135262960 GGGGACCAGCGGAAGGTGGGAGG + Intergenic
1033719768 7:144046856-144046878 GGGGACAGGCTGGAGGGAATGGG - Intergenic
1034404811 7:150896358-150896380 GGGGCCAGGATGGAGGGGAGGGG - Intergenic
1034899572 7:154899310-154899332 GGGGACAGGCTGAGGCCGACAGG + Intergenic
1035177208 7:157060035-157060057 TGGGACAGGGTGAATTTGAGTGG - Intergenic
1035230556 7:157463542-157463564 GGGGATGGGATGAGGGTGAGGGG - Intergenic
1036380315 8:8232380-8232402 GGGGACAGGATGGAGGGGAGGGG - Intergenic
1036571632 8:9984889-9984911 GAGGACACTCTGAGGGTGAGTGG - Intergenic
1036599182 8:10243338-10243360 AAGGACAAGCTGTAGGTGAGTGG - Intronic
1036622150 8:10431352-10431374 GGGGGCAGGCAGGAGGTCAGGGG - Intergenic
1036849245 8:12190280-12190302 GGGGACAGGATGGAGGGGAGGGG + Intronic
1036870606 8:12432554-12432576 GGGGACAGGATGGAGGGGAGGGG + Intronic
1037111497 8:15168665-15168687 GGGTACAGACTGAAGATGAATGG - Intronic
1038674576 8:29612229-29612251 GAGGAAAACCTGAAGGTGAGAGG + Intergenic
1038719931 8:30026449-30026471 GGGGCCAGGTGGAAGGTGACTGG - Intergenic
1039094854 8:33872467-33872489 GGGGAAAGGAAGAAGGTGGGAGG + Intergenic
1039805374 8:40992996-40993018 GGGGACAGGCAGCAGTTGTGAGG + Intergenic
1040758402 8:50808518-50808540 GGATACAGGCTGAAGATGAATGG - Intergenic
1040990759 8:53347253-53347275 GGGTACAGACTGAAGATGAATGG - Intergenic
1041796889 8:61754325-61754347 GGGGAAAGAAGGAAGGTGAGAGG - Intergenic
1042060726 8:64814246-64814268 GGAGACAGGATGTATGTGAGCGG + Intergenic
1042415085 8:68509665-68509687 GGGTACAGACTGAAGATGAATGG + Intronic
1045975947 8:108131094-108131116 GGGGACAGACTGATGGGCAGAGG + Intergenic
1046968718 8:120196007-120196029 GGGGAAATGCAGAAGGTGAATGG - Intronic
1047517752 8:125569740-125569762 GGGGGCTGGCTGAATGTCAGGGG + Intergenic
1047912741 8:129548226-129548248 GGGGACAGGAGGAAGGTAAGGGG - Intergenic
1048176069 8:132153931-132153953 GGGTACAGACTGAAGATGAATGG - Intronic
1048237314 8:132703644-132703666 GGGGAGGGGGTGGAGGTGAGTGG + Intronic
1048317273 8:133371530-133371552 GGGAACATGCTGAGGGAGAGGGG + Intergenic
1049006442 8:139858633-139858655 GGGGACAGGACACAGGTGAGGGG + Intronic
1049164220 8:141116608-141116630 GGGGACAGCGTGAAGCCGAGGGG + Intergenic
1049443954 8:142621627-142621649 AGGGACAGGCAGATGGGGAGTGG + Intergenic
1049473807 8:142787788-142787810 CTGGCTAGGCTGAAGGTGAGTGG + Intergenic
1049632431 8:143665798-143665820 AGGGACAGGAAGAAGGTGGGTGG + Intergenic
1049654492 8:143791759-143791781 GGGGAGAGGCAGAGAGTGAGAGG + Intronic
1049708966 8:144055222-144055244 GGGGCCAGGCTGTGGGTGGGTGG - Intronic
1049991566 9:996488-996510 GGGGACAGGCCAAAGGAGATAGG - Intergenic
1050245920 9:3689577-3689599 GGGGAGAGCCAGAAGGGGAGGGG + Intergenic
1050312914 9:4371567-4371589 GGGCACAGGCTGGGGGTTAGGGG - Intergenic
1050691709 9:8234554-8234576 GGGCACAGGCTGAGGGAGAAGGG + Intergenic
1051094204 9:13446503-13446525 TGGTACAGGCTGAAGCGGAGCGG + Intergenic
1052059361 9:23941976-23941998 GGGTACAGACTGAAGATGAATGG + Intergenic
1052391464 9:27883127-27883149 GGGGCCTGGCAGAAGGTGATTGG + Intergenic
1052540430 9:29804605-29804627 GGAGAGAGGATGCAGGTGAGTGG + Intergenic
1052617066 9:30854849-30854871 GGGTACAGACTGAAGATGAATGG - Intergenic
1052832691 9:33228920-33228942 GGGTCCAGGCAGAAGGTGGGAGG - Intronic
1055552809 9:77446640-77446662 GGGGAGATGCTCAAGGTGATGGG + Intronic
1057861651 9:98645490-98645512 GAGGAAAGGCTGAAGGTGCAGGG - Intronic
1058139493 9:101342491-101342513 GGGGACAGGGAGAGGGGGAGGGG + Intergenic
1058940243 9:109806755-109806777 GGGGAGTGGGTGAAGGAGAGTGG + Intronic
1058941489 9:109816749-109816771 GGGGACAGAGTTAAGGAGAGAGG + Intronic
1058974096 9:110109927-110109949 AGGGACTGGCTGGAGGGGAGGGG + Intronic
1059309254 9:113377081-113377103 CGGGAGAGGGCGAAGGTGAGGGG - Intergenic
1059416186 9:114163867-114163889 GGGGAGAGGCTGGAGCTGTGTGG + Intronic
1059499310 9:114737507-114737529 AGGGAGAGGCAGAAGGGGAGGGG - Intergenic
1059911280 9:119046839-119046861 GAGGCAAGGCTGAAGGTCAGAGG - Intergenic
1060299987 9:122369609-122369631 GGGGACAGGGTGGAGGTGTGGGG - Intergenic
1060898824 9:127239259-127239281 GAGGACAGGCTGAAGAAGAGAGG - Intronic
1061411280 9:130423118-130423140 GGGTGCAGGCTGGAGGTGACGGG + Intronic
1061508575 9:131046805-131046827 GGGGACAGGCGGAAGGTGCGGGG - Intronic
1061517094 9:131096398-131096420 GGGGAGAGGCGGGAGGGGAGGGG + Intergenic
1061517103 9:131096417-131096439 GGGGAGAGGCGGGAGGGGAGGGG + Intergenic
1061547964 9:131315603-131315625 AGGGACAGGGTGGAGGTGTGTGG + Intergenic
1061648714 9:132028365-132028387 GGAGACAGGGAGAAGGTGAGTGG - Intronic
1061898738 9:133662287-133662309 GGGGGAAGGCTGAGGATGAGGGG - Intergenic
1062021388 9:134321031-134321053 GGGAACAGGCTGACGGAGAGGGG + Intronic
1062458598 9:136653254-136653276 GGGGTCAGGCAGAGTGTGAGGGG + Intergenic
1062582589 9:137235083-137235105 GGGGACCTGCTGGAGGTGAGTGG - Intronic
1062722654 9:138052487-138052509 AGGGAGATGCTGGAGGTGAGGGG + Intronic
1185581272 X:1213045-1213067 GGGGAGAGGGGGAAGGGGAGGGG - Intergenic
1186767064 X:12781803-12781825 GGAGAGAAGCTGAAGGTCAGTGG + Intergenic
1187734243 X:22288571-22288593 GGGGAGAGGCAGAGGGAGAGGGG - Intergenic
1187843017 X:23508435-23508457 GGGGCCTGGTTGGAGGTGAGTGG + Intergenic
1188212400 X:27441647-27441669 GGGTACAGACTGAAGATGAATGG + Intergenic
1188763235 X:34057662-34057684 GGGTACAGACTGAAGATGAATGG - Intergenic
1188803596 X:34560392-34560414 GGGCACAGACTGAAGATGAATGG + Intergenic
1188862434 X:35272936-35272958 GGGTACAGACTGAAGATGAGTGG + Intergenic
1189006315 X:36999085-36999107 GGGTACAGACTGAAGATGAATGG - Intergenic
1189006407 X:36999641-36999663 GGGTACAGACTGAAGATGAATGG - Intergenic
1189042279 X:37554720-37554742 GGGTACAGACTGAAGATGAATGG + Intronic
1189059343 X:37736425-37736447 AGGAACAGGTTGAAGGTGACAGG - Intronic
1189326216 X:40112963-40112985 GTGGACTGGAGGAAGGTGAGGGG - Intronic
1189487954 X:41447146-41447168 GGGGCCAGGCAGATGGAGAGAGG + Intergenic
1190491104 X:50983393-50983415 GGGTACAGACTGAAGATGAATGG - Intergenic
1190559224 X:51670970-51670992 GGGGACACGCATAGGGTGAGTGG + Intergenic
1190565067 X:51722351-51722373 GGGGACACGCATAGGGTGAGTGG - Intergenic
1190569590 X:51768134-51768156 GGGGACATGCATAGGGTGAGTGG + Intergenic
1190736073 X:53256625-53256647 GGGGCCAGGCTGCAGGGGACAGG - Intronic
1190740332 X:53284358-53284380 GGGTGCAGGTTGAAGGTGGGGGG - Intronic
1190782302 X:53609752-53609774 GGGCACAGGGTGCAGGAGAGCGG + Intronic
1191042347 X:56097367-56097389 GGGTACAGGCTGAAGTGCAGTGG + Intergenic
1191842358 X:65522305-65522327 GGGGAGGGGCTTGAGGTGAGCGG + Intronic
1191902321 X:66053804-66053826 GGGAGTAGGCTGAAGGTGAAGGG - Intergenic
1192158963 X:68768787-68768809 GGGGCCAGGCTAAAGGTGCTGGG - Intergenic
1193667578 X:84341163-84341185 GGTGACTAGCTGAAGGAGAGTGG - Intronic
1194027491 X:88770761-88770783 GGGTACAGACTGAAGATGAATGG - Intergenic
1195369315 X:104157328-104157350 GGGCACAGGTTCAAGGTGAAAGG - Intergenic
1197062307 X:122195857-122195879 GGGTATAGGCTGAAGATGAGTGG - Intergenic
1197365768 X:125563134-125563156 GGGTACAGACTGAAGATGAATGG + Intergenic
1197636506 X:128920669-128920691 GGGGACAGGGTGATGGAAAGGGG + Intergenic
1197854865 X:130903450-130903472 GGGGACAATCGGAAGGGGAGGGG - Intergenic
1199078725 X:143552464-143552486 GGGGCCTGGTTGGAGGTGAGTGG + Intergenic
1199104181 X:143842154-143842176 GGGGCCTGGTTGAAGGTGATTGG + Intergenic
1200091747 X:153639228-153639250 AGGGACAGGAGGTAGGTGAGAGG - Intergenic
1200097449 X:153670834-153670856 GGGGAAAGGCTGAAGGTCAGGGG + Intronic
1200210755 X:154345707-154345729 GGGGCCAGGCACAGGGTGAGGGG + Intergenic
1200220097 X:154386385-154386407 GGGGCCAGGCACAGGGTGAGGGG - Intergenic
1202598104 Y:26564743-26564765 TGGGACAGGATTAAGGTGAGGGG + Intergenic