ID: 1077530668

View in Genome Browser
Species Human (GRCh38)
Location 11:3093370-3093392
Sequence TGGTGGCAGATCACGTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 140}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077530668_1077530676 8 Left 1077530668 11:3093370-3093392 CCAGGACACGTGATCTGCCACCA 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1077530676 11:3093401-3093423 CCAGGCCTGCCCTCCCTGCCAGG 0: 1
1: 1
2: 13
3: 106
4: 853
1077530668_1077530681 18 Left 1077530668 11:3093370-3093392 CCAGGACACGTGATCTGCCACCA 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1077530681 11:3093411-3093433 CCTCCCTGCCAGGGACATCCTGG 0: 1
1: 1
2: 3
3: 31
4: 295
1077530668_1077530682 19 Left 1077530668 11:3093370-3093392 CCAGGACACGTGATCTGCCACCA 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1077530682 11:3093412-3093434 CTCCCTGCCAGGGACATCCTGGG 0: 1
1: 1
2: 0
3: 35
4: 292
1077530668_1077530683 20 Left 1077530668 11:3093370-3093392 CCAGGACACGTGATCTGCCACCA 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1077530683 11:3093413-3093435 TCCCTGCCAGGGACATCCTGGGG 0: 1
1: 0
2: 4
3: 25
4: 264
1077530668_1077530677 9 Left 1077530668 11:3093370-3093392 CCAGGACACGTGATCTGCCACCA 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1077530677 11:3093402-3093424 CAGGCCTGCCCTCCCTGCCAGGG 0: 1
1: 0
2: 7
3: 77
4: 528
1077530668_1077530672 -10 Left 1077530668 11:3093370-3093392 CCAGGACACGTGATCTGCCACCA 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1077530672 11:3093383-3093405 TCTGCCACCAGGGGTGCACCAGG 0: 1
1: 0
2: 1
3: 16
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077530668 Original CRISPR TGGTGGCAGATCACGTGTCC TGG (reversed) Intronic