ID: 1077530672

View in Genome Browser
Species Human (GRCh38)
Location 11:3093383-3093405
Sequence TCTGCCACCAGGGGTGCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 190}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077530659_1077530672 18 Left 1077530659 11:3093342-3093364 CCACACCCCTTCCCTCCATCTGT 0: 1
1: 0
2: 9
3: 291
4: 1587
Right 1077530672 11:3093383-3093405 TCTGCCACCAGGGGTGCACCAGG 0: 1
1: 0
2: 1
3: 16
4: 190
1077530666_1077530672 3 Left 1077530666 11:3093357-3093379 CCATCTGTCCTTTCCAGGACACG 0: 1
1: 0
2: 2
3: 16
4: 202
Right 1077530672 11:3093383-3093405 TCTGCCACCAGGGGTGCACCAGG 0: 1
1: 0
2: 1
3: 16
4: 190
1077530658_1077530672 23 Left 1077530658 11:3093337-3093359 CCAGGCCACACCCCTTCCCTCCA 0: 1
1: 0
2: 10
3: 106
4: 897
Right 1077530672 11:3093383-3093405 TCTGCCACCAGGGGTGCACCAGG 0: 1
1: 0
2: 1
3: 16
4: 190
1077530667_1077530672 -5 Left 1077530667 11:3093365-3093387 CCTTTCCAGGACACGTGATCTGC 0: 1
1: 0
2: 0
3: 4
4: 119
Right 1077530672 11:3093383-3093405 TCTGCCACCAGGGGTGCACCAGG 0: 1
1: 0
2: 1
3: 16
4: 190
1077530660_1077530672 13 Left 1077530660 11:3093347-3093369 CCCCTTCCCTCCATCTGTCCTTT 0: 1
1: 0
2: 8
3: 147
4: 1246
Right 1077530672 11:3093383-3093405 TCTGCCACCAGGGGTGCACCAGG 0: 1
1: 0
2: 1
3: 16
4: 190
1077530662_1077530672 11 Left 1077530662 11:3093349-3093371 CCTTCCCTCCATCTGTCCTTTCC 0: 1
1: 4
2: 89
3: 1139
4: 9659
Right 1077530672 11:3093383-3093405 TCTGCCACCAGGGGTGCACCAGG 0: 1
1: 0
2: 1
3: 16
4: 190
1077530664_1077530672 7 Left 1077530664 11:3093353-3093375 CCCTCCATCTGTCCTTTCCAGGA 0: 1
1: 0
2: 3
3: 27
4: 404
Right 1077530672 11:3093383-3093405 TCTGCCACCAGGGGTGCACCAGG 0: 1
1: 0
2: 1
3: 16
4: 190
1077530665_1077530672 6 Left 1077530665 11:3093354-3093376 CCTCCATCTGTCCTTTCCAGGAC 0: 1
1: 0
2: 1
3: 16
4: 258
Right 1077530672 11:3093383-3093405 TCTGCCACCAGGGGTGCACCAGG 0: 1
1: 0
2: 1
3: 16
4: 190
1077530661_1077530672 12 Left 1077530661 11:3093348-3093370 CCCTTCCCTCCATCTGTCCTTTC 0: 1
1: 0
2: 15
3: 235
4: 2455
Right 1077530672 11:3093383-3093405 TCTGCCACCAGGGGTGCACCAGG 0: 1
1: 0
2: 1
3: 16
4: 190
1077530657_1077530672 28 Left 1077530657 11:3093332-3093354 CCTCTCCAGGCCACACCCCTTCC 0: 1
1: 0
2: 5
3: 96
4: 841
Right 1077530672 11:3093383-3093405 TCTGCCACCAGGGGTGCACCAGG 0: 1
1: 0
2: 1
3: 16
4: 190
1077530668_1077530672 -10 Left 1077530668 11:3093370-3093392 CCAGGACACGTGATCTGCCACCA 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1077530672 11:3093383-3093405 TCTGCCACCAGGGGTGCACCAGG 0: 1
1: 0
2: 1
3: 16
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077530672 Original CRISPR TCTGCCACCAGGGGTGCACC AGG Intronic