ID: 1077530674

View in Genome Browser
Species Human (GRCh38)
Location 11:3093390-3093412
Sequence GGGCAGGCCTGGTGCACCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 329}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077530674_1077530681 -2 Left 1077530674 11:3093390-3093412 CCAGGGGTGCACCAGGCCTGCCC 0: 1
1: 0
2: 3
3: 40
4: 329
Right 1077530681 11:3093411-3093433 CCTCCCTGCCAGGGACATCCTGG 0: 1
1: 1
2: 3
3: 31
4: 295
1077530674_1077530682 -1 Left 1077530674 11:3093390-3093412 CCAGGGGTGCACCAGGCCTGCCC 0: 1
1: 0
2: 3
3: 40
4: 329
Right 1077530682 11:3093412-3093434 CTCCCTGCCAGGGACATCCTGGG 0: 1
1: 1
2: 0
3: 35
4: 292
1077530674_1077530683 0 Left 1077530674 11:3093390-3093412 CCAGGGGTGCACCAGGCCTGCCC 0: 1
1: 0
2: 3
3: 40
4: 329
Right 1077530683 11:3093413-3093435 TCCCTGCCAGGGACATCCTGGGG 0: 1
1: 0
2: 4
3: 25
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077530674 Original CRISPR GGGCAGGCCTGGTGCACCCC TGG (reversed) Intronic