ID: 1077530676

View in Genome Browser
Species Human (GRCh38)
Location 11:3093401-3093423
Sequence CCAGGCCTGCCCTCCCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 974
Summary {0: 1, 1: 1, 2: 13, 3: 106, 4: 853}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077530661_1077530676 30 Left 1077530661 11:3093348-3093370 CCCTTCCCTCCATCTGTCCTTTC 0: 1
1: 0
2: 15
3: 235
4: 2455
Right 1077530676 11:3093401-3093423 CCAGGCCTGCCCTCCCTGCCAGG 0: 1
1: 1
2: 13
3: 106
4: 853
1077530664_1077530676 25 Left 1077530664 11:3093353-3093375 CCCTCCATCTGTCCTTTCCAGGA 0: 1
1: 0
2: 3
3: 27
4: 404
Right 1077530676 11:3093401-3093423 CCAGGCCTGCCCTCCCTGCCAGG 0: 1
1: 1
2: 13
3: 106
4: 853
1077530673_1077530676 -9 Left 1077530673 11:3093387-3093409 CCACCAGGGGTGCACCAGGCCTG 0: 1
1: 0
2: 2
3: 28
4: 264
Right 1077530676 11:3093401-3093423 CCAGGCCTGCCCTCCCTGCCAGG 0: 1
1: 1
2: 13
3: 106
4: 853
1077530668_1077530676 8 Left 1077530668 11:3093370-3093392 CCAGGACACGTGATCTGCCACCA 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1077530676 11:3093401-3093423 CCAGGCCTGCCCTCCCTGCCAGG 0: 1
1: 1
2: 13
3: 106
4: 853
1077530667_1077530676 13 Left 1077530667 11:3093365-3093387 CCTTTCCAGGACACGTGATCTGC 0: 1
1: 0
2: 0
3: 4
4: 119
Right 1077530676 11:3093401-3093423 CCAGGCCTGCCCTCCCTGCCAGG 0: 1
1: 1
2: 13
3: 106
4: 853
1077530662_1077530676 29 Left 1077530662 11:3093349-3093371 CCTTCCCTCCATCTGTCCTTTCC 0: 1
1: 4
2: 89
3: 1139
4: 9659
Right 1077530676 11:3093401-3093423 CCAGGCCTGCCCTCCCTGCCAGG 0: 1
1: 1
2: 13
3: 106
4: 853
1077530665_1077530676 24 Left 1077530665 11:3093354-3093376 CCTCCATCTGTCCTTTCCAGGAC 0: 1
1: 0
2: 1
3: 16
4: 258
Right 1077530676 11:3093401-3093423 CCAGGCCTGCCCTCCCTGCCAGG 0: 1
1: 1
2: 13
3: 106
4: 853
1077530666_1077530676 21 Left 1077530666 11:3093357-3093379 CCATCTGTCCTTTCCAGGACACG 0: 1
1: 0
2: 2
3: 16
4: 202
Right 1077530676 11:3093401-3093423 CCAGGCCTGCCCTCCCTGCCAGG 0: 1
1: 1
2: 13
3: 106
4: 853

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077530676 Original CRISPR CCAGGCCTGCCCTCCCTGCC AGG Intronic