ID: 1077530677

View in Genome Browser
Species Human (GRCh38)
Location 11:3093402-3093424
Sequence CAGGCCTGCCCTCCCTGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 613
Summary {0: 1, 1: 0, 2: 7, 3: 77, 4: 528}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077530664_1077530677 26 Left 1077530664 11:3093353-3093375 CCCTCCATCTGTCCTTTCCAGGA 0: 1
1: 0
2: 3
3: 27
4: 404
Right 1077530677 11:3093402-3093424 CAGGCCTGCCCTCCCTGCCAGGG 0: 1
1: 0
2: 7
3: 77
4: 528
1077530668_1077530677 9 Left 1077530668 11:3093370-3093392 CCAGGACACGTGATCTGCCACCA 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1077530677 11:3093402-3093424 CAGGCCTGCCCTCCCTGCCAGGG 0: 1
1: 0
2: 7
3: 77
4: 528
1077530666_1077530677 22 Left 1077530666 11:3093357-3093379 CCATCTGTCCTTTCCAGGACACG 0: 1
1: 0
2: 2
3: 16
4: 202
Right 1077530677 11:3093402-3093424 CAGGCCTGCCCTCCCTGCCAGGG 0: 1
1: 0
2: 7
3: 77
4: 528
1077530667_1077530677 14 Left 1077530667 11:3093365-3093387 CCTTTCCAGGACACGTGATCTGC 0: 1
1: 0
2: 0
3: 4
4: 119
Right 1077530677 11:3093402-3093424 CAGGCCTGCCCTCCCTGCCAGGG 0: 1
1: 0
2: 7
3: 77
4: 528
1077530665_1077530677 25 Left 1077530665 11:3093354-3093376 CCTCCATCTGTCCTTTCCAGGAC 0: 1
1: 0
2: 1
3: 16
4: 258
Right 1077530677 11:3093402-3093424 CAGGCCTGCCCTCCCTGCCAGGG 0: 1
1: 0
2: 7
3: 77
4: 528
1077530662_1077530677 30 Left 1077530662 11:3093349-3093371 CCTTCCCTCCATCTGTCCTTTCC 0: 1
1: 4
2: 89
3: 1139
4: 9659
Right 1077530677 11:3093402-3093424 CAGGCCTGCCCTCCCTGCCAGGG 0: 1
1: 0
2: 7
3: 77
4: 528
1077530673_1077530677 -8 Left 1077530673 11:3093387-3093409 CCACCAGGGGTGCACCAGGCCTG 0: 1
1: 0
2: 2
3: 28
4: 264
Right 1077530677 11:3093402-3093424 CAGGCCTGCCCTCCCTGCCAGGG 0: 1
1: 0
2: 7
3: 77
4: 528

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077530677 Original CRISPR CAGGCCTGCCCTCCCTGCCA GGG Intronic